ID: 1198177603

View in Genome Browser
Species Human (GRCh38)
Location X:134172136-134172158
Sequence TTCTTGCCCAGCCACCCGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177590_1198177603 30 Left 1198177590 X:134172083-134172105 CCACCCAACCAGTCAACTCTACC No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177594_1198177603 22 Left 1198177594 X:134172091-134172113 CCAGTCAACTCTACCGGATCACA No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177599_1198177603 -6 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177598_1198177603 -5 Left 1198177598 X:134172118-134172140 CCCCAACGAAGGGCTCCCTTCTT No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177600_1198177603 -7 Left 1198177600 X:134172120-134172142 CCAACGAAGGGCTCCCTTCTTGC No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177592_1198177603 27 Left 1198177592 X:134172086-134172108 CCCAACCAGTCAACTCTACCGGA No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177593_1198177603 26 Left 1198177593 X:134172087-134172109 CCAACCAGTCAACTCTACCGGAT No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data
1198177595_1198177603 9 Left 1198177595 X:134172104-134172126 CCGGATCACAGCTGCCCCAACGA No data
Right 1198177603 X:134172136-134172158 TTCTTGCCCAGCCACCCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177603 Original CRISPR TTCTTGCCCAGCCACCCGCT CGG Intergenic