ID: 1198177605

View in Genome Browser
Species Human (GRCh38)
Location X:134172142-134172164
Sequence GGTTTCCCGAGCGGGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177605_1198177626 27 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177605_1198177616 13 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177605_1198177622 25 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177622 X:134172190-134172212 CCCCTCGCAGGTGGAGAGCGCGG No data
1198177605_1198177613 -2 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177605_1198177617 16 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177617 X:134172181-134172203 TCCGGCCCGCCCCTCGCAGGTGG No data
1198177605_1198177624 26 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177624 X:134172191-134172213 CCCTCGCAGGTGGAGAGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177605 Original CRISPR GGTTTCCCGAGCGGGTGGCT GGG (reversed) Intergenic