ID: 1198177606

View in Genome Browser
Species Human (GRCh38)
Location X:134172143-134172165
Sequence CGGTTTCCCGAGCGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177606_1198177613 -3 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177606_1198177617 15 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177617 X:134172181-134172203 TCCGGCCCGCCCCTCGCAGGTGG No data
1198177606_1198177624 25 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177624 X:134172191-134172213 CCCTCGCAGGTGGAGAGCGCGGG No data
1198177606_1198177626 26 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177606_1198177622 24 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177622 X:134172190-134172212 CCCCTCGCAGGTGGAGAGCGCGG No data
1198177606_1198177616 12 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177606 Original CRISPR CGGTTTCCCGAGCGGGTGGC TGG (reversed) Intergenic