ID: 1198177609

View in Genome Browser
Species Human (GRCh38)
Location X:134172150-134172172
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177598_1198177609 9 Left 1198177598 X:134172118-134172140 CCCCAACGAAGGGCTCCCTTCTT No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177602_1198177609 -7 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177599_1198177609 8 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177595_1198177609 23 Left 1198177595 X:134172104-134172126 CCGGATCACAGCTGCCCCAACGA No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177600_1198177609 7 Left 1198177600 X:134172120-134172142 CCAACGAAGGGCTCCCTTCTTGC No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
1198177601_1198177609 -6 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177609 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177609 Original CRISPR CCCGCTCGGGAAACCGCGCG CGG Intergenic