ID: 1198177612

View in Genome Browser
Species Human (GRCh38)
Location X:134172163-134172185
Sequence CCGGAGCTGGGTCCCGCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177612_1198177622 4 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177622 X:134172190-134172212 CCCCTCGCAGGTGGAGAGCGCGG No data
1198177612_1198177624 5 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177624 X:134172191-134172213 CCCTCGCAGGTGGAGAGCGCGGG No data
1198177612_1198177626 6 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177612_1198177616 -8 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177612_1198177617 -5 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177617 X:134172181-134172203 TCCGGCCCGCCCCTCGCAGGTGG No data
1198177612_1198177627 17 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177612_1198177628 18 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177612 Original CRISPR CCGGAGCTGGGTCCCGCGCG CGG (reversed) Intergenic