ID: 1198177613

View in Genome Browser
Species Human (GRCh38)
Location X:134172163-134172185
Sequence CCGCGCGCGGGACCCAGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177600_1198177613 20 Left 1198177600 X:134172120-134172142 CCAACGAAGGGCTCCCTTCTTGC No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177608_1198177613 -10 Left 1198177608 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177598_1198177613 22 Left 1198177598 X:134172118-134172140 CCCCAACGAAGGGCTCCCTTCTT No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177605_1198177613 -2 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177601_1198177613 7 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177602_1198177613 6 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177599_1198177613 21 Left 1198177599 X:134172119-134172141 CCCAACGAAGGGCTCCCTTCTTG No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177606_1198177613 -3 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
1198177607_1198177613 -7 Left 1198177607 X:134172147-134172169 CCACCCGCTCGGGAAACCGCGCG No data
Right 1198177613 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177613 Original CRISPR CCGCGCGCGGGACCCAGCTC CGG Intergenic