ID: 1198177614

View in Genome Browser
Species Human (GRCh38)
Location X:134172175-134172197
Sequence GCGAGGGGCGGGCCGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177614_1198177628 6 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177614_1198177626 -6 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177614_1198177632 20 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177632 X:134172218-134172240 CCGCACGGGCCGCCCTCTCCGGG No data
1198177614_1198177627 5 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177614_1198177630 19 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177630 X:134172217-134172239 CCCGCACGGGCCGCCCTCTCCGG No data
1198177614_1198177622 -8 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177622 X:134172190-134172212 CCCCTCGCAGGTGGAGAGCGCGG No data
1198177614_1198177624 -7 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177624 X:134172191-134172213 CCCTCGCAGGTGGAGAGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177614 Original CRISPR GCGAGGGGCGGGCCGGAGCT GGG (reversed) Intergenic