ID: 1198177616

View in Genome Browser
Species Human (GRCh38)
Location X:134172178-134172200
Sequence AGCTCCGGCCCGCCCCTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177612_1198177616 -8 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177610_1198177616 4 Left 1198177610 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177605_1198177616 13 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177608_1198177616 5 Left 1198177608 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177607_1198177616 8 Left 1198177607 X:134172147-134172169 CCACCCGCTCGGGAAACCGCGCG No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177606_1198177616 12 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177602_1198177616 21 Left 1198177602 X:134172134-134172156 CCTTCTTGCCCAGCCACCCGCTC No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data
1198177601_1198177616 22 Left 1198177601 X:134172133-134172155 CCCTTCTTGCCCAGCCACCCGCT No data
Right 1198177616 X:134172178-134172200 AGCTCCGGCCCGCCCCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177616 Original CRISPR AGCTCCGGCCCGCCCCTCGC AGG Intergenic