ID: 1198177626

View in Genome Browser
Species Human (GRCh38)
Location X:134172192-134172214
Sequence CCTCGCAGGTGGAGAGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177607_1198177626 22 Left 1198177607 X:134172147-134172169 CCACCCGCTCGGGAAACCGCGCG No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177614_1198177626 -6 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177608_1198177626 19 Left 1198177608 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177615_1198177626 -7 Left 1198177615 X:134172176-134172198 CCAGCTCCGGCCCGCCCCTCGCA No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177610_1198177626 18 Left 1198177610 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177612_1198177626 6 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177605_1198177626 27 Left 1198177605 X:134172142-134172164 CCCAGCCACCCGCTCGGGAAACC No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data
1198177606_1198177626 26 Left 1198177606 X:134172143-134172165 CCAGCCACCCGCTCGGGAAACCG No data
Right 1198177626 X:134172192-134172214 CCTCGCAGGTGGAGAGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177626 Original CRISPR CCTCGCAGGTGGAGAGCGCG GGG Intergenic