ID: 1198177627

View in Genome Browser
Species Human (GRCh38)
Location X:134172203-134172225
Sequence GAGAGCGCGGGGATCCCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177618_1198177627 -2 Left 1198177618 X:134172182-134172204 CCGGCCCGCCCCTCGCAGGTGGA No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177610_1198177627 29 Left 1198177610 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177608_1198177627 30 Left 1198177608 X:134172150-134172172 CCCGCTCGGGAAACCGCGCGCGG No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177615_1198177627 4 Left 1198177615 X:134172176-134172198 CCAGCTCCGGCCCGCCCCTCGCA No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177621_1198177627 -10 Left 1198177621 X:134172190-134172212 CCCCTCGCAGGTGGAGAGCGCGG No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177614_1198177627 5 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177619_1198177627 -6 Left 1198177619 X:134172186-134172208 CCCGCCCCTCGCAGGTGGAGAGC No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177612_1198177627 17 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data
1198177620_1198177627 -7 Left 1198177620 X:134172187-134172209 CCGCCCCTCGCAGGTGGAGAGCG No data
Right 1198177627 X:134172203-134172225 GAGAGCGCGGGGATCCCGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177627 Original CRISPR GAGAGCGCGGGGATCCCGCA CGG Intergenic