ID: 1198177628

View in Genome Browser
Species Human (GRCh38)
Location X:134172204-134172226
Sequence AGAGCGCGGGGATCCCGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177623_1198177628 -10 Left 1198177623 X:134172191-134172213 CCCTCGCAGGTGGAGAGCGCGGG No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177615_1198177628 5 Left 1198177615 X:134172176-134172198 CCAGCTCCGGCCCGCCCCTCGCA No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177621_1198177628 -9 Left 1198177621 X:134172190-134172212 CCCCTCGCAGGTGGAGAGCGCGG No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177619_1198177628 -5 Left 1198177619 X:134172186-134172208 CCCGCCCCTCGCAGGTGGAGAGC No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177620_1198177628 -6 Left 1198177620 X:134172187-134172209 CCGCCCCTCGCAGGTGGAGAGCG No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177610_1198177628 30 Left 1198177610 X:134172151-134172173 CCGCTCGGGAAACCGCGCGCGGG No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177612_1198177628 18 Left 1198177612 X:134172163-134172185 CCGCGCGCGGGACCCAGCTCCGG No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177618_1198177628 -1 Left 1198177618 X:134172182-134172204 CCGGCCCGCCCCTCGCAGGTGGA No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data
1198177614_1198177628 6 Left 1198177614 X:134172175-134172197 CCCAGCTCCGGCCCGCCCCTCGC No data
Right 1198177628 X:134172204-134172226 AGAGCGCGGGGATCCCGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177628 Original CRISPR AGAGCGCGGGGATCCCGCAC GGG Intergenic