ID: 1198177825 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:134173029-134173051 |
| Sequence | TAGTGGGTGAAGAGGGCGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198177825_1198177831 | -7 | Left | 1198177825 | X:134173029-134173051 | CCAGGCGCCCTCTTCACCCACTA | No data | ||
| Right | 1198177831 | X:134173045-134173067 | CCCACTAAATCAGGGTTTCTTGG | No data | ||||
| 1198177825_1198177833 | -3 | Left | 1198177825 | X:134173029-134173051 | CCAGGCGCCCTCTTCACCCACTA | No data | ||
| Right | 1198177833 | X:134173049-134173071 | CTAAATCAGGGTTTCTTGGCAGG | No data | ||||
| 1198177825_1198177834 | 9 | Left | 1198177825 | X:134173029-134173051 | CCAGGCGCCCTCTTCACCCACTA | No data | ||
| Right | 1198177834 | X:134173061-134173083 | TTCTTGGCAGGTATCGTTAACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198177825 | Original CRISPR | TAGTGGGTGAAGAGGGCGCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||