ID: 1198177825

View in Genome Browser
Species Human (GRCh38)
Location X:134173029-134173051
Sequence TAGTGGGTGAAGAGGGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198177825_1198177831 -7 Left 1198177825 X:134173029-134173051 CCAGGCGCCCTCTTCACCCACTA No data
Right 1198177831 X:134173045-134173067 CCCACTAAATCAGGGTTTCTTGG No data
1198177825_1198177833 -3 Left 1198177825 X:134173029-134173051 CCAGGCGCCCTCTTCACCCACTA No data
Right 1198177833 X:134173049-134173071 CTAAATCAGGGTTTCTTGGCAGG No data
1198177825_1198177834 9 Left 1198177825 X:134173029-134173051 CCAGGCGCCCTCTTCACCCACTA No data
Right 1198177834 X:134173061-134173083 TTCTTGGCAGGTATCGTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198177825 Original CRISPR TAGTGGGTGAAGAGGGCGCC TGG (reversed) Intergenic
No off target data available for this crispr