ID: 1198186647

View in Genome Browser
Species Human (GRCh38)
Location X:134259778-134259800
Sequence TAGTGCCCTGAAAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198186638_1198186647 17 Left 1198186638 X:134259738-134259760 CCCCAGCAGCTATGCTTAAACTG No data
Right 1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG No data
1198186637_1198186647 18 Left 1198186637 X:134259737-134259759 CCCCCAGCAGCTATGCTTAAACT No data
Right 1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG No data
1198186643_1198186647 -9 Left 1198186643 X:134259764-134259786 CCTGACTGTGCGGCTAGTGCCCT No data
Right 1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG No data
1198186642_1198186647 -8 Left 1198186642 X:134259763-134259785 CCCTGACTGTGCGGCTAGTGCCC No data
Right 1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG No data
1198186640_1198186647 15 Left 1198186640 X:134259740-134259762 CCAGCAGCTATGCTTAAACTGAA No data
Right 1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG No data
1198186639_1198186647 16 Left 1198186639 X:134259739-134259761 CCCAGCAGCTATGCTTAAACTGA No data
Right 1198186647 X:134259778-134259800 TAGTGCCCTGAAAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198186647 Original CRISPR TAGTGCCCTGAAAGGGAAGT GGG Intergenic
No off target data available for this crispr