ID: 1198189353

View in Genome Browser
Species Human (GRCh38)
Location X:134287510-134287532
Sequence AGATGCCAGCTGCAGTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198189347_1198189353 0 Left 1198189347 X:134287487-134287509 CCTGTCTGGAGCAGCTGCTGCAA No data
Right 1198189353 X:134287510-134287532 AGATGCCAGCTGCAGTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198189353 Original CRISPR AGATGCCAGCTGCAGTGGGG GGG Intergenic
No off target data available for this crispr