ID: 1198205415

View in Genome Browser
Species Human (GRCh38)
Location X:134460437-134460459
Sequence CCGGGCCCAGGGAACCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198205402_1198205415 14 Left 1198205402 X:134460400-134460422 CCCTGAGGCGCGGGATCCGCAGT 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1198205415 X:134460437-134460459 CCGGGCCCAGGGAACCCCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 235
1198205401_1198205415 19 Left 1198205401 X:134460395-134460417 CCGGGCCCTGAGGCGCGGGATCC 0: 1
1: 0
2: 1
3: 7
4: 167
Right 1198205415 X:134460437-134460459 CCGGGCCCAGGGAACCCCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 235
1198205409_1198205415 -2 Left 1198205409 X:134460416-134460438 CCGCAGTGCGGGCTCGGGCGGCC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1198205415 X:134460437-134460459 CCGGGCCCAGGGAACCCCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 235
1198205403_1198205415 13 Left 1198205403 X:134460401-134460423 CCTGAGGCGCGGGATCCGCAGTG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1198205415 X:134460437-134460459 CCGGGCCCAGGGAACCCCGCAGG 0: 1
1: 0
2: 1
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198205415 Original CRISPR CCGGGCCCAGGGAACCCCGC AGG Intronic
900113883 1:1020521-1020543 CCGGGTCCCGGGAAACTCGCGGG + Intronic
900163638 1:1236176-1236198 CCGGGCACAGGGAACTGGGCTGG - Intergenic
900218809 1:1496090-1496112 CAGGGGCCACGGAACCCGGCAGG + Exonic
900666642 1:3820021-3820043 CCGGACCCAGGGAACCCGTGAGG + Intronic
901456861 1:9368028-9368050 CCCGGCCCAGGGTGCCCAGCGGG + Exonic
901500855 1:9651969-9651991 CCGGGTCCTGGGAGCCCCGGGGG + Intronic
901772343 1:11536782-11536804 CTGGGCCCAGGGCGCCCTGCGGG + Exonic
902386362 1:16078177-16078199 CCTGGCCCCTGGAACCCCCCAGG - Intergenic
902823567 1:18957344-18957366 CCGGGCACAGCTAAGCCCGCTGG + Intergenic
904195375 1:28781558-28781580 CCAGGCCCAGGGCACGGCGCCGG + Intergenic
904306401 1:29592909-29592931 CTGGGCTCAGGGCTCCCCGCTGG + Intergenic
904778266 1:32925114-32925136 CCTCCCCCAGGGACCCCCGCGGG - Intergenic
905959910 1:42035336-42035358 CCGGGCACAGGGAACGCGGCTGG + Intronic
906058965 1:42936162-42936184 CCTGGCCCAGGGATCCCTGCTGG - Intronic
906480682 1:46197383-46197405 CCAGGCCCAGGGACCCAAGCGGG + Intronic
906719822 1:47996947-47996969 CCGGCCCCAGAGAAACCCCCAGG - Intergenic
912381037 1:109248513-109248535 CCAGGCCCAGGCATCCCCCCAGG + Intergenic
913077503 1:115353422-115353444 CCTGGCCCAGGGACCACTGCTGG - Intergenic
913317559 1:117565719-117565741 AGGTGCCCAGGGAACCCTGCAGG - Intergenic
914490802 1:148149082-148149104 CTGGGCCCGGGGACGCCCGCTGG + Intronic
914755230 1:150558490-150558512 CCGGGGCCAGAGAAGCCGGCAGG + Exonic
914802968 1:150974174-150974196 CCAGGCCAGGGCAACCCCGCGGG + Intronic
915675703 1:157527849-157527871 CTGGGCCCTGGGAACCCTGAGGG + Exonic
915936556 1:160093169-160093191 CCGGGCCCAGGTGCCCCCGCAGG + Exonic
916116142 1:161486573-161486595 CAGGGCCCAGGGAACCAAGGAGG - Intergenic
917803684 1:178594337-178594359 CAGGGACCAGGGGAACCCGCTGG - Intergenic
918064414 1:181089584-181089606 CCGGGCGCCGGGCAGCCCGCTGG - Exonic
919731701 1:200916949-200916971 CATGGCCCAGGGAAGCCTGCTGG - Intergenic
921389732 1:214606136-214606158 CTGGGCCCGGGGACGCCCGCTGG - Intronic
922334616 1:224608624-224608646 CCAGGCCCAGGGCACGGCGCCGG + Intronic
922689804 1:227679355-227679377 CCAGGCCCAGGGCACAGCGCTGG - Intergenic
922695250 1:227728236-227728258 CAGGGTCCAGCGAACCCTGCAGG - Intergenic
922726549 1:227925546-227925568 CCGGCCCCAGGAAGCCCTGCTGG + Intronic
923463863 1:234231427-234231449 CCGGGCCCGGGGAGTCCCGGGGG - Exonic
923564154 1:235064134-235064156 CCTGGCCAAGGGAACCATGCAGG + Intergenic
1063115580 10:3069135-3069157 CCAGGCCCAGCGCCCCCCGCGGG + Intronic
1065058539 10:21872946-21872968 CCAGGCCCAGGGCACGGCGCCGG - Intronic
1071630235 10:87213881-87213903 CCGAGCCCAGGCAGCCCTGCAGG + Intergenic
1076142820 10:128093170-128093192 CCGGGCCCTGGAACCCCCACCGG - Intergenic
1076944736 10:133638093-133638115 CGGGCCCCAGGGAACAGCGCGGG - Intergenic
1077043296 11:533956-533978 CAGGGCTCAGGGACCCCCTCAGG + Intronic
1077046921 11:550875-550897 CCGGGTCCAGGGATGCCCTCTGG - Intronic
1077081299 11:725853-725875 GCGACCCCAGGGACCCCCGCGGG - Intronic
1077404764 11:2377965-2377987 CCGCGGCCAGGGACCCGCGCAGG - Intronic
1077409183 11:2395550-2395572 CAGGGCCCCGGGAACCCGGCGGG + Intronic
1080389020 11:31827029-31827051 CCGAGCCCAGTGAGCCCAGCCGG + Intronic
1081861521 11:46335799-46335821 CCAGGCCCAGGGGACCCCAGGGG + Intronic
1081872907 11:46391441-46391463 CCGGGGCTGGGGGACCCCGCTGG - Intergenic
1083613115 11:64013820-64013842 CCGGGCAGAGGGAACAGCGCAGG - Intronic
1084330072 11:68425022-68425044 CGGAGCCCAGGGCACCCAGCTGG - Intronic
1085332725 11:75667394-75667416 CTGGGCCCCGGGCAGCCCGCGGG + Intronic
1085511741 11:77091673-77091695 CCTGGCCCAGGGAACAGAGCAGG - Intronic
1088193722 11:107253768-107253790 CCAGGCCCAGGGCACGGCGCCGG - Intergenic
1091850611 12:3693963-3693985 ACGGGCCCCTGGAACCCAGCAGG - Intronic
1094653416 12:32399342-32399364 CCGCGCCCAGGGCGCTCCGCTGG + Intergenic
1097011465 12:55956205-55956227 GGGGGCCCAGGGAACCTGGCAGG + Exonic
1097895880 12:64824674-64824696 CCGAGCGCAGGGAAGCCAGCAGG - Exonic
1099457422 12:82880641-82880663 CAGGGCCCTTGGAACCCTGCAGG - Intronic
1101904455 12:108814540-108814562 CTGTGCCCAGGGAATCCCGGGGG - Intronic
1105319565 13:19305542-19305564 CCGGGCCCAGGGCAGCACCCAGG + Intergenic
1105472091 13:20703787-20703809 CTGGGCCCCGGGGACCCCGCGGG + Intronic
1105844523 13:24282625-24282647 CTGGGGCCAGGGAAGCCAGCTGG - Intronic
1105893530 13:24699134-24699156 CAGGGCCCAGGGAACAGCACAGG + Intronic
1112280586 13:98059543-98059565 CCTGGCCCAGAGAACCCCTGAGG + Intergenic
1113650546 13:112031368-112031390 CAGGGCCCAGAGAAGCCCTCTGG - Intergenic
1113782553 13:112985064-112985086 CCAGGCACAAGGGACCCCGCTGG - Intronic
1119323731 14:73746423-73746445 CAGGACCCAGGGATCCCAGCAGG + Intronic
1119779865 14:77270598-77270620 CCCGGCCCGGTGAGCCCCGCTGG + Intronic
1119891930 14:78189414-78189436 CCAGGCCCAGGGGACACTGCAGG - Intergenic
1120781790 14:88492329-88492351 CCAGCCCCAGGGAACCCCAAAGG + Intronic
1121565754 14:94908168-94908190 CCGTGCCCAGAGAAACCCACTGG - Intergenic
1122238431 14:100345882-100345904 CCGGGCCCTGGGCACGCGGCTGG + Intronic
1122717336 14:103703508-103703530 CCGGGGCCAGGTGACCCCTCAGG + Intronic
1122720107 14:103716755-103716777 CAGGTCACAGGGAACCCCACGGG - Intronic
1122849726 14:104521283-104521305 CAGGGCTCAGGGAACCATGCTGG - Intronic
1123506114 15:20942177-20942199 CATGGCCCCGGGAACCCCGGCGG - Intergenic
1123739946 15:23226447-23226469 CTGGGCCCGGGGACGCCCGCTGG - Intergenic
1124291170 15:28455415-28455437 CTGGGCCCGGGGACGCCCGCTGG - Intergenic
1124336499 15:28861265-28861287 CCGGGCCCAGCCTACCCAGCTGG + Intergenic
1124624602 15:31300666-31300688 GCGGTCCCAGGGTACCCCACAGG - Intergenic
1126315533 15:47365361-47365383 CAGTGCCCAGGGACTCCCGCAGG + Intronic
1128494997 15:68192666-68192688 CCGGGCACAGGGAAAACTGCAGG - Exonic
1128866007 15:71115625-71115647 CCCGGCGCCGGGAACCACGCGGG + Intronic
1129162222 15:73753165-73753187 CCAGGCCCCGGGAGCCCGGCGGG - Intergenic
1129539330 15:76338107-76338129 CCGGGCCCGGGAATGCCCGCAGG + Intronic
1131151179 15:90048367-90048389 CCTGCCCCTGGGAACCCCGTGGG - Intronic
1132371418 15:101302027-101302049 CCGGGCCCAGGGAAGGAAGCTGG - Intronic
1202971698 15_KI270727v1_random:243018-243040 CATGGCCCCGGGAACCCCGGCGG - Intergenic
1132641535 16:980678-980700 CCGGGCCGAGGCCACCTCGCGGG + Intronic
1132692135 16:1186311-1186333 CTGGGCCCAGGGAGCCCTGAAGG + Intronic
1132759574 16:1502211-1502233 CCGGGCCCAGGGCTTCCCGGTGG - Intronic
1133219838 16:4315446-4315468 CCTGGCCAAGGTGACCCCGCGGG + Exonic
1134294715 16:12935568-12935590 CCGGGCCCAGGGGCTCACGCTGG + Intronic
1134849810 16:17470656-17470678 CCGGGGCCGGGGAGCGCCGCGGG - Exonic
1136147044 16:28321852-28321874 CCAGGCCCAGGGACCTCTGCCGG + Exonic
1136188235 16:28600693-28600715 CCGGCCCCAGGGCACCGCGCAGG - Intergenic
1136190707 16:28613687-28613709 CCGGCCCCAGGGCACCGCGCAGG - Intronic
1136394869 16:29987329-29987351 CCTGGCCCAGGGTACCGCACTGG + Exonic
1136453827 16:30369732-30369754 CCAGGACCAGGGACCCCCACCGG - Exonic
1136707600 16:32202250-32202272 CTGGGCCCGGGGACGCCCGCTGG + Intergenic
1136760310 16:32727160-32727182 CTGGGCCCGGGGACGCCCGCTGG - Intergenic
1136807794 16:33143226-33143248 CTGGGCCCGGGGACGCCCGCTGG + Intergenic
1136927634 16:34389098-34389120 CGGGCCCCAGCCAACCCCGCGGG - Intergenic
1136976940 16:35022708-35022730 CGGGCCCCAGCCAACCCCGCGGG + Exonic
1139950591 16:70666459-70666481 TCTGCCCCAGGGAACCCTGCCGG - Intronic
1141604615 16:85145738-85145760 CAGGACCCAGGGCACCCCGTCGG - Intergenic
1142133715 16:88442334-88442356 CCTGGCAAAGGGAACCCTGCAGG - Intergenic
1203062464 16_KI270728v1_random:987482-987504 CTGGGCCCGGGGACGCCCGCTGG - Intergenic
1143614113 17:8039469-8039491 CCGGGGCCAGGGGCCCCAGCAGG - Exonic
1145041335 17:19580043-19580065 CCGGGGGCAGCGCACCCCGCAGG - Intergenic
1145191385 17:20843678-20843700 CTGGGCCCGGGGACGCCCGCTGG + Intronic
1145261050 17:21355075-21355097 CCGAGCCCAGGGCCCCTCGCGGG + Intergenic
1146397891 17:32483491-32483513 CCGGGCCCAGGCCAGCCCACCGG - Intergenic
1147139653 17:38453948-38453970 CCGGGCCCGGGAGCCCCCGCCGG + Intronic
1147477296 17:40724405-40724427 TAGGGACCAGGGAACCCTGCAGG - Intergenic
1147732109 17:42610283-42610305 CCTGGTACTGGGAACCCCGCTGG + Intronic
1147739068 17:42660009-42660031 CCTGGTACTGGGAACCCCGCTGG + Intronic
1148754948 17:49968628-49968650 CCAGGCCCAGGGCGCCCCGCGGG + Intergenic
1149119958 17:53150916-53150938 CCAGGCCCAGGGCACAGCGCTGG - Intergenic
1149894901 17:60421920-60421942 CCTGCCCCAGGGAAGGCCGCGGG + Intronic
1150410316 17:64936520-64936542 ACGGGCCCAGGTAATCCCCCAGG + Intergenic
1151563544 17:74884044-74884066 CAAGGCCCTGGGAACCCCACAGG - Intronic
1151603158 17:75118965-75118987 CTGTGCCCTGGGAACCCAGCTGG + Intronic
1152242240 17:79166668-79166690 CCTGGCCGAGGGAAGCCCCCAGG + Intronic
1152357267 17:79813319-79813341 CCGGGCGCAGGGACCCTCCCGGG - Intergenic
1152735715 17:81995924-81995946 CAGAGCCCAGGGAAGCCCTCCGG - Intronic
1153238810 18:3013001-3013023 CCGCGCCAAGGGAAGCCCCCAGG + Intronic
1160497815 18:79385395-79385417 CCGGGGCCAGGCCACACCGCCGG + Intergenic
1160509526 18:79445424-79445446 CCGGGGCCAGGGAACCAGGCAGG - Intronic
1160577201 18:79863547-79863569 CCCGGCCCCTGGATCCCCGCGGG + Intergenic
1160696570 19:487855-487877 CCAGGCCCAGGGCACAGCGCCGG - Intergenic
1160994817 19:1877744-1877766 CTGGGCCCGGGGACGCCCGCTGG - Intronic
1161139027 19:2637111-2637133 CCGGGGCCAGGAAACTCCGTGGG + Intronic
1161159726 19:2755157-2755179 CCGGGCACAGGGAAGGCAGCTGG - Exonic
1161265097 19:3360141-3360163 CCCGGGCCGGGGCACCCCGCGGG - Intronic
1161332786 19:3696314-3696336 CCGGGCGCAGGGGATGCCGCAGG + Intronic
1161973436 19:7596265-7596287 CCGAGCCCGGGGACCCCCGGCGG - Intronic
1163157867 19:15449234-15449256 CCGGGCCCAGGCAACCGGGGCGG + Intronic
1163417103 19:17193409-17193431 CCGGGCACAGAGAAGCCCCCAGG + Intronic
1164121946 19:22273486-22273508 CCAGGCCCAGGGCACGGCGCTGG + Intergenic
1164178412 19:22798231-22798253 CCAGGCCCAGGGCACGGCGCTGG + Intergenic
1165902248 19:39174335-39174357 CGGGGCACAGGGAACCCAGGAGG - Intronic
1166756728 19:45197018-45197040 CTGTGCCCAGGAAACCCCGTGGG - Intronic
1167072860 19:47230774-47230796 CCTGGCCCAGGGTCCCTCGCGGG + Intronic
1168398181 19:56066537-56066559 CCAGGGTCAGTGAACCCCGCGGG + Intergenic
927215848 2:20667430-20667452 GCGGGCCCGGGGAACCGCGGCGG - Exonic
927965021 2:27262987-27263009 CCGACCCCCGGGATCCCCGCAGG + Exonic
929452819 2:42048151-42048173 CCGGGGCCGGGGAGCCGCGCGGG + Exonic
929946560 2:46376774-46376796 CCAGGCCCCTGGAACCCCGTTGG + Intronic
932769016 2:74490144-74490166 CCGGGCCCAGGGATCGAGGCTGG + Intronic
933729014 2:85443302-85443324 CCTGGCCCAGGGACCCCAGCTGG + Intergenic
935918602 2:107986035-107986057 CAGGGCCCAGGGGAGGCCGCGGG + Intergenic
936531392 2:113278870-113278892 CCGGGCCCAGGGCACCCTCGCGG - Exonic
943407727 2:187510595-187510617 CCAGGCCCAGGGCACAGCGCCGG - Intronic
947727314 2:232408533-232408555 ACGGGTCCAGGGAAGCCTGCAGG - Exonic
948431685 2:237922912-237922934 CCCAGCCCAGGGAGCCCCACGGG + Intergenic
949034557 2:241810555-241810577 CAGGGCCCAGGGATCCCCCACGG + Intronic
949044294 2:241863850-241863872 CCGGGCCAAGGGCACCGCGGTGG + Intergenic
1171782073 20:29428088-29428110 CGGGCCCCAGGGAACAGCGCGGG - Intergenic
1172358681 20:34297227-34297249 CCGGACCCACTGAACCCAGCAGG + Intronic
1173865256 20:46308718-46308740 CCAGTCCCAGGAAACCCCCCAGG + Intergenic
1174388054 20:50198471-50198493 CCGGGCCCAGGAGACCTCGTAGG + Intergenic
1175827079 20:61942182-61942204 CCGTGCCCAGGGAGCCCCCTCGG + Intergenic
1175847172 20:62065239-62065261 CCTGGCCCTGGCAAGCCCGCCGG - Exonic
1175891761 20:62318879-62318901 CCGGGACCTGGGGGCCCCGCAGG - Exonic
1176064907 20:63189256-63189278 CCAGCCCCAGGGGACCCAGCAGG + Intergenic
1176289431 21:5036335-5036357 CCGGGCCCAGGGCACCTCCCGGG - Intronic
1176310761 21:5147693-5147715 CGGGGCCCAGGGAAACGAGCTGG + Intronic
1176370329 21:6058473-6058495 CCGGGCCCAGGTGACACCGTGGG + Intergenic
1178081819 21:29073813-29073835 GCGGGCCCAGGGAGCCCCTCGGG + Intergenic
1179722515 21:43323742-43323764 CCGGGACCCGGGCACCTCGCAGG - Intergenic
1179753190 21:43480068-43480090 CCGGGCCCAGGTGACACCGTGGG - Intergenic
1179846294 21:44114342-44114364 CGGGGCCCAGGGAAACGAGCTGG - Intronic
1179867799 21:44227252-44227274 CCGGGCCCAGGGCACCTCCCGGG + Intronic
1180926131 22:19556208-19556230 GGAGGCCCAGGGAACCCCACAGG + Intergenic
1180979995 22:19873899-19873921 CCAGGCCCAGGGGACCCCGCAGG - Intergenic
1181062827 22:20290173-20290195 GCCGGCCCAGGGAACCAGGCAGG + Intergenic
1181120875 22:20668277-20668299 CTGGGCCCGGGGACGCCCGCTGG - Intergenic
1181333836 22:22115302-22115324 CTGGGCCCGGGGACGCCCGCTGG - Intergenic
1181422849 22:22813853-22813875 CTGGTCCCAGGGAGCCCCTCAGG + Intronic
1181878891 22:25961633-25961655 CAGGGCCCGGGGAACCACCCTGG + Intronic
1183430589 22:37763221-37763243 CCGTGCCCAGGGAGCCTCGGGGG + Intronic
950640665 3:14346228-14346250 CCTGGCTTGGGGAACCCCGCTGG - Intergenic
951080429 3:18445163-18445185 CCGGGCCCTGGCCGCCCCGCTGG - Intronic
951329823 3:21353569-21353591 CTAGGCCCAGGGCACCACGCCGG - Intergenic
952495300 3:33910630-33910652 CAAAGCCCAGGGAACCCCCCAGG - Intergenic
954107880 3:48419079-48419101 CTGGGCCCAGGGAGTCCTGCAGG + Intronic
954617666 3:51977894-51977916 CCGGTCCCAGGTAGCCCTGCTGG + Exonic
954630978 3:52047487-52047509 CCAGGCCTGGGGAAGCCCGCGGG - Intergenic
957083416 3:75658311-75658333 CGGGCCCCAGGGAACAGCGCGGG + Intergenic
960926000 3:122795304-122795326 CCGGGACCCGGGACCGCCGCGGG - Exonic
961305670 3:125958206-125958228 CCGCGCCCAGCGTGCCCCGCCGG + Intergenic
961789693 3:129366622-129366644 CCTGTCCCAGGGCACCCCCCCGG + Intergenic
962021093 3:131502737-131502759 CCGGGCCCAGGGCAGCACCCAGG + Exonic
967325888 3:188239200-188239222 CAGGGCCCAGGCATCCCTGCAGG - Intronic
967726158 3:192864324-192864346 ACTGGTCCAGGAAACCCCGCAGG + Intronic
968461800 4:729995-730017 CCGGGACCAGGGGACCACGTAGG - Intronic
968471692 4:785608-785630 CTGCGCGCAGGGAACCCCGCAGG + Exonic
968505276 4:968447-968469 CCGGCCCCAGGGAGCCCTGGGGG - Intronic
969154837 4:5201341-5201363 CCGGCCCCATGGAAACCTGCAGG - Intronic
969660578 4:8525261-8525283 GCTGGCCCAAGGAACCCCGCTGG + Intergenic
969846540 4:9924313-9924335 CTGTGCCCAGGGAAAGCCGCAGG - Intronic
970183810 4:13428166-13428188 CCAGGCCCAGGGCGCGCCGCCGG + Intronic
970423437 4:15926010-15926032 CGGGGGCCAGGGCACCCAGCTGG - Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
983219645 4:165032051-165032073 CAGGACCCATGGAACCCCGCGGG - Exonic
985467573 5:12294-12316 GCGGGCCCAGGGCACCGCGAGGG - Intergenic
988578007 5:32444851-32444873 GCGGGCGCGGGGAAGCCCGCGGG + Intergenic
988686497 5:33530423-33530445 CCGGGCTCTGGGAAGCCCCCTGG + Intronic
989676736 5:43981759-43981781 CCTGCCCCAGGGAACTCCGCAGG + Intergenic
998040072 5:138946128-138946150 GCGGGCCCAGGCAGCCCCTCCGG - Intergenic
1002399726 5:178984873-178984895 CCTGGCCCTGAGAACCCAGCTGG + Intronic
1002784992 6:393450-393472 GCGAGCCCAGGGGACCGCGCGGG + Intronic
1003115599 6:3281812-3281834 CCTGGCCCAGGGACCCCCTTTGG + Intronic
1003868180 6:10381966-10381988 CCGGGCCCTGGGAAGACCCCGGG + Intergenic
1005905570 6:30259752-30259774 CCCGGCCCGGGGAGCCGCGCCGG + Intergenic
1005953532 6:30647890-30647912 CCGCTCCCAAGGAACCCCCCAGG - Intronic
1006828559 6:36954889-36954911 CCGGGCCCAGGTATCCCCGACGG + Exonic
1011564317 6:88658451-88658473 CAGGGGCCAGGTAGCCCCGCTGG + Intronic
1016076854 6:139805542-139805564 GAGGGCCCAGGAAACCCCCCTGG - Intergenic
1017914062 6:158818677-158818699 GCGGGCCCAGGGATACCCGGCGG + Intronic
1018899036 6:168042067-168042089 CTGGTTCCTGGGAACCCCGCAGG + Exonic
1019114880 6:169751867-169751889 CCTGGCCCAGGGAGGCCGGCAGG - Intronic
1019524929 7:1476569-1476591 GCGGGACCAGCGCACCCCGCAGG - Exonic
1020007392 7:4789898-4789920 CCGGCCCCAGGGTACGCTGCCGG + Exonic
1020013787 7:4819822-4819844 CAGGGCCCAGGGATGCCTGCAGG - Intronic
1020080631 7:5283990-5284012 CCTGGCCCAGTGACCCCCTCCGG - Intronic
1022091932 7:27113698-27113720 CCGCGCCGAGGGGACCCGGCCGG - Intronic
1025198290 7:56948180-56948202 CCTGGCCCAGTGACCCCCTCCGG + Intergenic
1025673659 7:63628753-63628775 CCTGGCCCAGTGACCCCCTCCGG - Intergenic
1025940962 7:66075982-66076004 CCCGGCCCGGGGGACCCTGCTGG + Intronic
1027774232 7:82444117-82444139 CCGTCCCCCGGGAGCCCCGCGGG - Intergenic
1029278259 7:99420335-99420357 CCTGCCCCAGGGTACCCAGCGGG - Intronic
1029371746 7:100154941-100154963 CCGGGAGCAGGGATCCCCTCTGG + Exonic
1029927134 7:104329388-104329410 CCGGGGCTGGGGAACCCCGGGGG - Intronic
1032197437 7:129797534-129797556 CTGGGCCCAGGAAACACGGCTGG + Intergenic
1033306887 7:140231461-140231483 CCGAGCCAATGGAAGCCCGCGGG + Intergenic
1034266871 7:149785345-149785367 CTGGGCCAAGGGAACCCTGCAGG + Intergenic
1034339068 7:150340832-150340854 CAGGCCCCAGGGAACAGCGCGGG - Exonic
1035743233 8:1944451-1944473 CAGAGCCCAGTGAACCCGGCGGG - Intronic
1039936790 8:42052214-42052236 CCGGCCCCACGTGACCCCGCCGG - Intergenic
1041526823 8:58815642-58815664 CTGGGCCCATGGAACACCGACGG + Exonic
1049585583 8:143431071-143431093 CCGCGCCCGGGGACCCCCTCGGG + Intergenic
1053482314 9:38424566-38424588 CCGGGCCGCGGGCACCGCGCGGG - Intergenic
1057186218 9:93058809-93058831 CCTGCCCCAGGGAACCGCACAGG + Exonic
1059633902 9:116154250-116154272 CCGGGCCCGGAGAGACCCGCGGG + Exonic
1061493870 9:130960851-130960873 AAGGGCCCAGGGCACCCTGCTGG + Intergenic
1061545277 9:131300843-131300865 CTGGGCCCAGTGTACCCCCCGGG + Intronic
1062044129 9:134417425-134417447 CAGGGCCCAGGGCAGCCCCCAGG - Intronic
1062601447 9:137320286-137320308 CAGGGCCCAGGGTACCCTCCAGG + Intronic
1186497353 X:10022151-10022173 CAGAGCCAAGGGATCCCCGCAGG - Intronic
1190633335 X:52410939-52410961 CTGGGAACTGGGAACCCCGCGGG - Intergenic
1198205415 X:134460437-134460459 CCGGGCCCAGGGAACCCCGCAGG + Intronic
1199949817 X:152698907-152698929 CCGGGCCTGGGCCACCCCGCAGG + Intronic
1199959857 X:152769554-152769576 CCGGGCCTGGGCCACCCCGCAGG - Intronic
1200123681 X:153803308-153803330 CCAGGCCCAGGGAACCCCCTGGG - Exonic
1200404023 Y:2790235-2790257 CCGGGCCAAGGAAGCCCCACAGG - Intergenic