ID: 1198205418

View in Genome Browser
Species Human (GRCh38)
Location X:134460442-134460464
Sequence CCCCGCCTGCGGGGTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198205418_1198205428 -1 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205428 X:134460464-134460486 GGCGGCCAGTTTCCCGGGTTCGG 0: 1
1: 0
2: 0
3: 10
4: 44
1198205418_1198205437 28 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205437 X:134460493-134460515 GTCACGCGAGGGCGGCAGGGAGG 0: 1
1: 0
2: 0
3: 23
4: 90
1198205418_1198205435 24 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205435 X:134460489-134460511 TTACGTCACGCGAGGGCGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 10
1198205418_1198205436 25 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205436 X:134460490-134460512 TACGTCACGCGAGGGCGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 9
1198205418_1198205433 17 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205433 X:134460482-134460504 TTCGGCTTTACGTCACGCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 2
1198205418_1198205426 -7 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205426 X:134460458-134460480 GGCGGGGGCGGCCAGTTTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 163
1198205418_1198205434 20 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205434 X:134460485-134460507 GGCTTTACGTCACGCGAGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 11
1198205418_1198205427 -6 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205427 X:134460459-134460481 GCGGGGGCGGCCAGTTTCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 152
1198205418_1198205432 16 Left 1198205418 X:134460442-134460464 CCCAGGGAACCCCGCAGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1198205432 X:134460481-134460503 GTTCGGCTTTACGTCACGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 2

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198205418 Original CRISPR CCCCGCCTGCGGGGTTCCCT GGG (reversed) Intronic
900789035 1:4667140-4667162 CCCCGCCTGGGGAGTCCTCTGGG - Intronic
901137621 1:7008033-7008055 CCCAGCCTGCGTGTTTCTCTGGG + Intronic
901458662 1:9378262-9378284 CTCGGCCTGGGGGCTTCCCTCGG - Intergenic
902224949 1:14990932-14990954 CCCCACCTGCTGTTTTCCCTGGG - Intronic
902386360 1:16078172-16078194 CCCTGCCTGGGGGGTTCCAGGGG + Intergenic
902816684 1:18920522-18920544 CCCCACCTGCGGTGTAACCTGGG - Intronic
905369433 1:37475127-37475149 CCCTGCCTTCTGGGTCCCCTGGG + Intronic
907213485 1:52842865-52842887 CCCCGCCGCCGGGGTTGCCATGG + Exonic
907962463 1:59296567-59296589 CCGCGGCTGCAGCGTTCCCTGGG - Intergenic
919528229 1:198680366-198680388 CTCCGCCTGCCGGGTTCACGCGG - Intronic
921215942 1:212936826-212936848 CACCACCTGCCTGGTTCCCTGGG - Intergenic
923147602 1:231209122-231209144 CCCCGCCTTCGGGGTGGCCAGGG + Exonic
1063771366 10:9205925-9205947 CCCAGCCTTCCTGGTTCCCTAGG - Intergenic
1069634695 10:69918055-69918077 CTCAGTCTGCGGGGCTCCCTGGG - Intronic
1070590993 10:77800862-77800884 CCCAGCCTGGGGTGTTCCCTAGG - Intronic
1070785228 10:79158717-79158739 CCCCACCTCCAGGGATCCCTGGG - Intronic
1070856998 10:79614002-79614024 CCCGACCTGCGGGCTCCCCTCGG - Exonic
1073097239 10:100987285-100987307 CCGCGCCTGCGCACTTCCCTTGG + Intronic
1073460091 10:103661229-103661251 CCCCGGCTGCGGGCTGCCCCTGG - Intronic
1076616392 10:131757956-131757978 CCCAGGCTGGGGGGTTCCCAGGG - Intergenic
1076853404 10:133103886-133103908 CCCATCCTCTGGGGTTCCCTGGG + Intronic
1076878968 10:133230826-133230848 CCCCGCCTACCTGGTTCGCTGGG - Exonic
1076944733 10:133638088-133638110 CCCTGCCCGCGCTGTTCCCTGGG + Intergenic
1076981574 11:207608-207630 CCCCGCCTGCCGGGCTCCCAAGG + Intronic
1082653020 11:55817959-55817981 CTCCGCCTCCTGGGTTCACTGGG + Intergenic
1083716627 11:64581260-64581282 CTCCGCCTGGGGGGTTCCTCTGG - Intergenic
1085225016 11:74911891-74911913 CCCCACCTTCAGGGTACCCTGGG - Intronic
1089631110 11:119784782-119784804 CCCTGCCTGCTGGGATCCATCGG - Intergenic
1091274628 11:134342119-134342141 ACCCGGCTGAGGGGCTCCCTGGG + Intronic
1092918344 12:13208389-13208411 CCCAGACTGAGGGTTTCCCTGGG + Intronic
1094845630 12:34360225-34360247 CCCCGCATGCGGGGCTCCCATGG - Intergenic
1097011466 12:55956210-55956232 CCTCTCCTGCCAGGTTCCCTGGG - Exonic
1098134555 12:67388643-67388665 ACCTGCCTGCAGGGTTCCCGGGG + Intergenic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1101904453 12:108814535-108814557 CCCAGCCCCCGGGATTCCCTGGG + Intronic
1104614052 12:130253956-130253978 CCCCGCCAGCAGGATTCACTGGG + Intergenic
1105472093 13:20703792-20703814 CGCCGCCCGCGGGGTCCCCGGGG - Intronic
1105571820 13:21610602-21610624 CTCAGCCTGGGGGCTTCCCTAGG + Intergenic
1106076643 13:26466201-26466223 CCCTGGCTGTGGGCTTCCCTGGG + Intergenic
1111126029 13:83911693-83911715 CCCGGGCTGCGGGCTTTCCTTGG + Intergenic
1111311662 13:86495625-86495647 CCCCTCCTGCTTGCTTCCCTTGG + Intergenic
1111738665 13:92174448-92174470 CCCCGCCTCCCGGGTTCACGCGG - Intronic
1119496606 14:75084903-75084925 CCAGGACTGCGGGGTTTCCTGGG + Intronic
1121108352 14:91295514-91295536 CCCAGCCGGCTTGGTTCCCTGGG - Intronic
1122143455 14:99675642-99675664 CCCCGCCGGCGGGATGGCCTGGG - Exonic
1122264472 14:100540242-100540264 CCCCGGCTGCTGGTTGCCCTCGG - Intronic
1122960768 14:105092836-105092858 CCTGGCTTGCGGGGATCCCTGGG + Intergenic
1123080457 14:105691393-105691415 CCCTGCCTCGGGGGTCCCCTCGG + Intergenic
1125182637 15:36895115-36895137 TCCCGCCTCTGGGCTTCCCTGGG - Intronic
1129767500 15:78179470-78179492 GCCCGCCTGCTGAGTGCCCTGGG - Intronic
1131693658 15:94853991-94854013 CCCAGGCTGCAGGGTTCCCTAGG + Intergenic
1131827241 15:96331406-96331428 CCCGGCCTGCCTGGCTCCCTGGG + Exonic
1132324741 15:100959318-100959340 CCCAGCCTGCGGGCAGCCCTGGG + Intronic
1132692137 16:1186316-1186338 CCCTGCCTTCAGGGCTCCCTGGG - Intronic
1132888272 16:2191974-2191996 CCACCCCGTCGGGGTTCCCTGGG + Intronic
1135842167 16:25886827-25886849 CACCACCTGCGGGGTTCTCCAGG - Intronic
1137019946 16:35414932-35414954 CCCTGCCTGCACTGTTCCCTGGG + Intergenic
1137530338 16:49275391-49275413 CCTCGCCTGCGCGGCTCCCGGGG + Intergenic
1140046323 16:71442325-71442347 CCCAGGCTGCGGCGTTCCCCAGG + Intergenic
1142347875 16:89565582-89565604 CCCCACCAGCGGGGTATCCTGGG - Exonic
1143202621 17:5122901-5122923 CCCCGGCTTCGGGGTGCTCTCGG - Intronic
1144337913 17:14288129-14288151 CTCCACCTGCTGGGTCCCCTTGG - Intergenic
1147155375 17:38542132-38542154 CCCCATCTCCGGGGTTGCCTGGG - Intronic
1147438026 17:40429934-40429956 CTCCCCCTGGGGGGTTCCCCAGG - Intergenic
1147686206 17:42288276-42288298 CCCCGACGGCGGGGTCCCCCGGG - Exonic
1147918547 17:43902496-43902518 TCCAGCCTGCTGGGCTCCCTGGG - Intronic
1148646872 17:49224299-49224321 CCGCGCCAGCGTGGTGCCCTGGG - Exonic
1148826396 17:50397338-50397360 CCCCGGCTCCGGGGTTCCGGCGG + Exonic
1150128427 17:62653315-62653337 CCCCGCCCCTGGGGTTCTCTGGG - Intronic
1153238811 18:3013006-3013028 CTGCGCCTGGGGGCTTCCCTTGG - Intronic
1155031808 18:21991383-21991405 CCCCAACTGAGGGATTCCCTTGG - Intergenic
1161057570 19:2198368-2198390 CCCCTCCTGGGGGCTTCCCGCGG + Intronic
1161067752 19:2247026-2247048 GCGTGGCTGCGGGGTTCCCTGGG + Intronic
1161976895 19:7612124-7612146 CACCGCCTTCGGGGACCCCTCGG - Exonic
1164473413 19:28554579-28554601 CACCACCTGCGGGGATCCCTTGG - Intergenic
1165407128 19:35637771-35637793 CCCCGCCTGGGTGTTTGCCTGGG - Intergenic
1165787976 19:38473681-38473703 CCCCGCCTGCGGGGTGCCCCCGG - Exonic
1167272582 19:48514151-48514173 CCCCGCCTGTGCCGCTCCCTAGG - Intergenic
1168494883 19:56840071-56840093 CCCTTCCTGCGGGGTGCCATCGG - Intronic
925611702 2:5706865-5706887 CCCTGCCTGCGCGGGTCCCGTGG + Intergenic
926123015 2:10255060-10255082 CCCCGTCTCCGGGGTGTCCTGGG + Intergenic
927552153 2:24010122-24010144 CTCCGGCTGCGGGGACCCCTTGG - Exonic
928465285 2:31517762-31517784 CCCAGACTGAGGGGTTTCCTGGG - Intergenic
931292052 2:60881740-60881762 CCCCGCCGGCAGAGGTCCCTCGG + Exonic
934708401 2:96500407-96500429 CCTCCCCTGCGGGGTCCCCATGG + Intronic
935396955 2:102619510-102619532 CCCCGCCCGCGGGCCGCCCTGGG + Intergenic
940650379 2:156435729-156435751 CCCGGCCGGCAGGCTTCCCTAGG - Exonic
941666543 2:168247908-168247930 CCCCGCCCTCGGGGTCCCCAGGG - Exonic
947906206 2:233765146-233765168 CCCAAACTGAGGGGTTCCCTAGG - Intronic
948151407 2:235747581-235747603 CCTCACCTGCGGGATTCTCTTGG + Intronic
948653320 2:239462453-239462475 CCCCGGTTCCGGAGTTCCCTGGG - Intergenic
948717836 2:239876764-239876786 CCCAGCCTGCAGGACTCCCTGGG + Intergenic
948807374 2:240458888-240458910 GCCAGCCTGGGGGGTGCCCTGGG - Intronic
1169569211 20:6888302-6888324 CCCTGGCTGTGGGCTTCCCTGGG - Intergenic
1171782070 20:29428083-29428105 CCCTGCCCGCGCTGTTCCCTGGG + Intergenic
1174368450 20:50070505-50070527 CCCCACCTGCTGGGTGACCTTGG + Intergenic
1175793023 20:61754297-61754319 CCCTGCCTTCGGGGATGCCTTGG - Intronic
1175825488 20:61934368-61934390 CCCCTCCAGCGGGGTGGCCTGGG + Intronic
1176241114 20:64076417-64076439 TCCTGCCTGCGGGGATGCCTCGG + Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1180839064 22:18950308-18950330 CCGGGCCTGCCTGGTTCCCTGGG + Intergenic
1180979994 22:19873894-19873916 CTGTGCCTGCGGGGTCCCCTGGG + Intergenic
1181062829 22:20290178-20290200 CCGGGCCTGCCTGGTTCCCTGGG - Intergenic
1182293353 22:29298830-29298852 CTCCTCCAGAGGGGTTCCCTCGG - Exonic
1182828277 22:33284180-33284202 CCCAGCCTGCTTGGTTCCCTGGG + Intronic
1182887350 22:33786609-33786631 CCCCTCCTGAGGGGGTCCCCTGG + Intronic
1184789360 22:46689897-46689919 CCCAGGGTGGGGGGTTCCCTGGG - Intronic
950525079 3:13518678-13518700 TCCCGCCTGCAGGCTTCCCCGGG - Intergenic
950670822 3:14524379-14524401 CCCCGCCCGGTGGGTGCCCTTGG - Exonic
953191018 3:40688226-40688248 CCCAGACTGAGGGGTTTCCTGGG - Intergenic
954671074 3:52291682-52291704 CCCTGCTTGCCTGGTTCCCTGGG + Intronic
957083419 3:75658316-75658338 CCCTGCCCGCGCTGTTCCCTGGG - Intergenic
961795885 3:129408589-129408611 CCCCAGCTCTGGGGTTCCCTTGG + Intronic
965400496 3:168207377-168207399 CTCCGCCTGCCGGGTTCACAGGG + Intergenic
968472039 4:786777-786799 CCACGCCTTCGGGGGTTCCTGGG - Intronic
968607640 4:1543026-1543048 CCCCATCTGAGGGGCTCCCTGGG - Intergenic
969533057 4:7740195-7740217 CCACGCCTGAGTGGTTGCCTAGG - Exonic
969846538 4:9924308-9924330 CTCCGCCTGCGGCTTTCCCTGGG + Intronic
980469658 4:133234462-133234484 TCCAGGCTGTGGGGTTCCCTAGG - Intergenic
988889077 5:35594917-35594939 CTCCGCCTCCCGGGTTCACTTGG + Intergenic
989676738 5:43981764-43981786 CTAAGCCTGCGGAGTTCCCTGGG - Intergenic
999296643 5:150463691-150463713 CACTGCCTGCAGGGTTCCCAGGG + Intergenic
1002329962 5:178434541-178434563 CCCAGCCTGGGGCCTTCCCTGGG + Intronic
1002602574 5:180362366-180362388 CCAGGACTGAGGGGTTCCCTGGG - Intergenic
1016590002 6:145734779-145734801 CCCCCCCTTCGCGGGTCCCTTGG - Intronic
1018620703 6:165727002-165727024 CCTCGCGTGGGGGGTTCCCCTGG + Intronic
1019178989 6:170175677-170175699 CCCAGCCTGCGGGGCTCCGTGGG - Intergenic
1020020171 7:4861766-4861788 CGCCGGCTGCGGTGGTCCCTGGG + Exonic
1020023533 7:4883332-4883354 CCCAGCCTGCGGGGATCCGGGGG - Intronic
1022047087 7:26630557-26630579 CCCCGGCTGCTGGCTTCCCCTGG - Intergenic
1024237735 7:47410507-47410529 CCACGCCTGCGGGGTCCCTCTGG - Intronic
1027851958 7:83461962-83461984 CCCGGCCTGCGGGCATTCCTTGG - Intronic
1028363785 7:90002602-90002624 ACCAGCCTGCGGGGCTCTCTTGG - Intergenic
1033732899 7:144195854-144195876 CCGCGCCCTCGGGGCTCCCTGGG - Intergenic
1033743751 7:144294434-144294456 CCGCGCCCTCGGGGCTCCCTGGG - Intergenic
1033750150 7:144355163-144355185 CCGCGCCCTCGGGGCTCCCTGGG + Intergenic
1034339065 7:150340827-150340849 CCCTGCCCGCGCTGTTCCCTGGG + Exonic
1034489937 7:151387678-151387700 CCACCCCTGCGGGGCTCCCTTGG - Intronic
1035282803 7:157787964-157787986 CCCCGGCTGCGTGGTTCCCAGGG - Intronic
1039921631 8:41897306-41897328 GCGCGCCTCCGGGGCTCCCTGGG + Intergenic
1040296730 8:46152729-46152751 CCCCACCTGAGGGGCTCCCGGGG + Intergenic
1042212261 8:66392504-66392526 CCCTGCCTGAGGGCTCCCCTTGG - Intergenic
1046074917 8:109303108-109303130 CCCAGGCTGCGGGCTTTCCTTGG - Intronic
1049480044 8:142818284-142818306 CCCCGGCTCCGCGGCTCCCTGGG - Intergenic
1049535606 8:143179640-143179662 CCCCGACTGCAGTGTTCTCTAGG + Intergenic
1052871389 9:33510954-33510976 CCCCGCCTCCTGAGCTCCCTCGG - Intergenic
1053393782 9:37754034-37754056 CCCCGCCTGCGGGTCTCTCCCGG - Intronic
1055514360 9:77020949-77020971 CCACGCCCGCCGGGTCCCCTAGG - Exonic
1057186220 9:93058814-93058836 CCTCACCTGTGCGGTTCCCTGGG - Exonic
1060278477 9:122199811-122199833 CCTGGCCTGGGGGGTTCCCCAGG - Intronic
1061481084 9:130898042-130898064 CGAAGCCTGTGGGGTTCCCTGGG + Intergenic
1062186047 9:135219109-135219131 TCCTGCCTGCGGGGGTCCCCAGG - Intergenic
1062341249 9:136094845-136094867 CGCCGCCTGCTGGGTTTCCCTGG - Intronic
1062584329 9:137242084-137242106 CCCCGGCTGCGCAGTTCCCACGG - Intronic
1062657664 9:137612691-137612713 CCTCGCCTGCCTGATTCCCTTGG + Intronic
1188152895 X:26701008-26701030 CCAGGACTGAGGGGTTCCCTGGG - Intergenic
1190774226 X:53539787-53539809 CTCCCCCTGTGGGGTTCCATCGG + Exonic
1198205418 X:134460442-134460464 CCCCGCCTGCGGGGTTCCCTGGG - Intronic