ID: 1198212237

View in Genome Browser
Species Human (GRCh38)
Location X:134527099-134527121
Sequence TGGAGGGTGAATGCAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198212237_1198212242 8 Left 1198212237 X:134527099-134527121 CCTCATTTTGCATTCACCCTCCA No data
Right 1198212242 X:134527130-134527152 CTGAGAAAGAGTACAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198212237 Original CRISPR TGGAGGGTGAATGCAAAATG AGG (reversed) Intergenic
No off target data available for this crispr