ID: 1198216278

View in Genome Browser
Species Human (GRCh38)
Location X:134557763-134557785
Sequence TCCACTGCCAAGGGTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198216278_1198216284 30 Left 1198216278 X:134557763-134557785 CCTGACCCACCCTTGGCAGTGGA No data
Right 1198216284 X:134557816-134557838 ACCAGTCTCACTGTTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198216278 Original CRISPR TCCACTGCCAAGGGTGGGTC AGG (reversed) Intergenic
No off target data available for this crispr