ID: 1198217175

View in Genome Browser
Species Human (GRCh38)
Location X:134566282-134566304
Sequence CTGGCTACTCTCATGGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198217169_1198217175 3 Left 1198217169 X:134566256-134566278 CCTTCTGGGCTGTGGCCCTGCTC 0: 1
1: 1
2: 5
3: 37
4: 399
Right 1198217175 X:134566282-134566304 CTGGCTACTCTCATGGAGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 161
1198217165_1198217175 21 Left 1198217165 X:134566238-134566260 CCTCGTAGCATTTCTCATCCTTC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1198217175 X:134566282-134566304 CTGGCTACTCTCATGGAGCAGGG 0: 1
1: 0
2: 2
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198217175 Original CRISPR CTGGCTACTCTCATGGAGCA GGG Exonic
900271206 1:1789899-1789921 AGGGCTAATCTCATGGAGGAAGG + Intronic
900348836 1:2225244-2225266 CTGGCTCCTCTGGTGGACCAGGG - Intergenic
901001621 1:6151750-6151772 CTGGCTCCTGCCATGGTGCAGGG + Intronic
901326644 1:8370234-8370256 CTGCCTGCTTTCATGCAGCATGG - Intronic
905417552 1:37814646-37814668 CTGCCCTCTCTGATGGAGCAAGG + Exonic
906603868 1:47151411-47151433 CTGGCCACCCTGATGGGGCAGGG + Intergenic
914785678 1:150827445-150827467 CTGGCTTCTTTCATTGAGCATGG + Intronic
1063211107 10:3882108-3882130 TTGGCTGCTCCCAAGGAGCAGGG + Intergenic
1064138560 10:12771263-12771285 ATGGCTATTCTCATGAAGAAAGG - Intronic
1064556221 10:16549729-16549751 CAGTAAACTCTCATGGAGCAGGG - Intergenic
1065423427 10:25573437-25573459 CTTACTACACTCATGGAGCATGG - Intronic
1065612212 10:27483109-27483131 CTGGCTGCTCTCATGGAGCCAGG + Intergenic
1066519291 10:36197643-36197665 CTGGGGACTGTCAGGGAGCAGGG + Intergenic
1068947791 10:62746840-62746862 CAGGCCACTCTCCTGGAACAGGG - Intergenic
1069961328 10:72081019-72081041 CTGGCTTCCCTCCTGGAACATGG + Intronic
1073619217 10:105029613-105029635 GTGGCTTCTCTGATGGAGCTGGG + Intronic
1080551547 11:33376853-33376875 CTGGCGGCCCTCCTGGAGCACGG + Intergenic
1084126257 11:67101007-67101029 CTGGCTTCTCTCAGAGAGAAAGG + Intergenic
1084724347 11:70931089-70931111 CTGGCTGCTTTCACTGAGCATGG - Intronic
1085620800 11:78036758-78036780 CTGGCTGCCCTCATGGAGCTTGG - Intronic
1089591807 11:119546607-119546629 CTGGCTCCCATCTTGGAGCAAGG + Intergenic
1090663150 11:128895808-128895830 CAGGCTGCTCTTATGGAGCAGGG + Intronic
1091080298 11:132660786-132660808 CAGCCGACTGTCATGGAGCAGGG - Intronic
1094054619 12:26256416-26256438 CTGACTACTCTCTGGGGGCAGGG + Intronic
1097262720 12:57728579-57728601 CTGCCTACTCTCATGGCTCTTGG - Intronic
1101999423 12:109547641-109547663 TTGGCTGCTGTCAGGGAGCAGGG - Intergenic
1103820157 12:123691416-123691438 CTGGCTTCTTTCACTGAGCATGG + Intronic
1108078805 13:46710989-46711011 CTGGCCACTCTCATGGACTCAGG + Intronic
1113483117 13:110636078-110636100 CTGGCCACTCCCACGGAGCCTGG + Intronic
1119898467 14:78240390-78240412 CTGGCTGGTCCCATGGAACATGG + Intergenic
1121965201 14:98297106-98297128 CTGGCCACCCTCAGGCAGCATGG + Intergenic
1202898022 14_GL000194v1_random:21225-21247 CTGAGTGCTCTCATGGAGCCTGG - Intergenic
1127607417 15:60601238-60601260 CTGGCTTCTATAATTGAGCAAGG + Intronic
1128633917 15:69290918-69290940 CTGGCTGCTCTCCTGGGGCCTGG - Intergenic
1128806875 15:70537641-70537663 CTGTCCAGTCTCATGAAGCAAGG - Intergenic
1129958245 15:79659004-79659026 CTGCTTCCTCTCATGGAGGAAGG + Intergenic
1132467341 16:83401-83423 CTGGCTACGCTGACGGGGCAGGG + Intronic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1137816894 16:51406766-51406788 TTGGTTACTCTCATGAAGTACGG - Intergenic
1138102708 16:54266828-54266850 CTGGCTTCTTTCATTTAGCATGG + Intronic
1138199373 16:55077687-55077709 CAGGGGACTCTCAGGGAGCAGGG + Intergenic
1138443311 16:57047743-57047765 CAGGGGACTCTCATGGGGCAGGG - Intronic
1138840146 16:60491751-60491773 CTGGCTTCTCTGATGCAGAAGGG + Intergenic
1139160137 16:64495093-64495115 GTGGTTCCTCTCATGGAGCTTGG + Intergenic
1140321354 16:73954759-73954781 CTGCCTACTCTAAGAGAGCAAGG - Intergenic
1145835663 17:27952574-27952596 CTGCCTACTCCCATGCAGCCCGG + Intergenic
1147547224 17:41411416-41411438 CTTGCTCCTCTCATGGAGTTTGG + Intergenic
1149354530 17:55826422-55826444 ATGGATACTCTCATGAAGCATGG - Intronic
1151957804 17:77389142-77389164 CTGGCTCCTCGCAGGGAGCTGGG + Intronic
1152024528 17:77800166-77800188 CTGGCTTCTTTCACTGAGCATGG - Intergenic
1152635072 17:81427514-81427536 CTGGCTACTCTCAGGCTGCCTGG + Intronic
1155517262 18:26636452-26636474 CTGGCCAGTCTCAGGCAGCAGGG - Intronic
1157172714 18:45422700-45422722 CTGGCTCCATTGATGGAGCAGGG - Intronic
1157297279 18:46455499-46455521 CCAGCTACTCTCCTGCAGCAAGG - Intronic
1160686694 19:440092-440114 CTGGCGTCTCTCACTGAGCATGG - Intronic
1161236477 19:3200883-3200905 CTGGCTTCTCTCACTGAGGAGGG + Intronic
1161582605 19:5088930-5088952 CTGGCTTCTCTCACTGAGCGGGG - Intronic
1163250765 19:16125154-16125176 CTGGCTCCCCTCATGGCCCACGG - Intronic
1164607959 19:29613533-29613555 CTGGCTGCTCTGATGCAGCCAGG - Intronic
1165150250 19:33756049-33756071 ATGGCACCTCTCTTGGAGCAAGG + Intronic
928370326 2:30735888-30735910 CTGGCCAGTCTCAGGGTGCAGGG + Intronic
932252885 2:70259470-70259492 CTGGCTACCATGATGGTGCAGGG + Exonic
933914087 2:86970894-86970916 CTGGCTTCTTTCATTTAGCAAGG + Intronic
934008906 2:87799004-87799026 CTGGCTTCTTTCATTTAGCAAGG - Intronic
934979001 2:98825077-98825099 CTGGCCCCTCTCAGGGATCAAGG - Intronic
935772552 2:106440004-106440026 CTGGCTTCTTTCATTTAGCAAGG - Intronic
935907520 2:107855910-107855932 CTGGCTTCTTTCATTTAGCAAGG + Intronic
935993922 2:108748065-108748087 CTGGCTTCTTTCATTTAGCAAGG + Intronic
938734750 2:134175936-134175958 CTGGCTATTTTCTGGGAGCAGGG + Intronic
940240649 2:151559777-151559799 CTGGGTCCTCTCAGGGAGTAGGG + Intronic
941472624 2:165907754-165907776 CTGTCAGCTCTCATGGAGGATGG - Exonic
941512286 2:166426694-166426716 CTGGCTACCCTTGTGGAGTAGGG + Intronic
941601363 2:167547184-167547206 GTGGCTGCTCTCATGGTGGAAGG - Intergenic
942442803 2:176053479-176053501 GAGGCTACTCTGATGGGGCATGG + Intergenic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
948641327 2:239377661-239377683 CTGGCTTCTCACAAGGGGCAGGG + Intronic
948779329 2:240308286-240308308 ATGGCTCCTCCCCTGGAGCAAGG - Intergenic
1168736443 20:142779-142801 CTGGCTTCTCACTGGGAGCAGGG + Intronic
1169813383 20:9631222-9631244 CTGCCTACACTCATGGAGAGGGG - Intronic
1170285000 20:14697174-14697196 CTGGCTAAGCTCATGGAACTGGG + Intronic
1170822661 20:19767496-19767518 CTGGCTAGCCTCAGGGAGGATGG + Intergenic
1171308708 20:24128158-24128180 CTGGCCTGTCTCATGGAACATGG - Intergenic
1171442760 20:25178723-25178745 CTCCCTTCTCTCATGGAGCTGGG - Intergenic
1171720630 20:28559627-28559649 GTGGCTACTGTAATGGATCAAGG - Intergenic
1171863439 20:30422582-30422604 GTGGCTACTGTAATGGATCAAGG + Intergenic
1175470100 20:59221478-59221500 CTGGCTGCTGGCAGGGAGCATGG + Intronic
1180799383 22:18624692-18624714 GTGGCCGCTCTCATAGAGCAGGG + Intergenic
1180904323 22:19398031-19398053 CTGGCTAGCCTCATGCAGCGTGG - Exonic
1181222335 22:21370574-21370596 GTGGCCGCTCTCATAGAGCAGGG - Intergenic
1181761610 22:25062573-25062595 CTGGCTCCTTTCACGCAGCACGG + Intronic
1183069224 22:35384618-35384640 CTGGATTCTCTCATGGATCTTGG - Intronic
1183751173 22:39721576-39721598 CTGGCTACTCTCCTGTGCCACGG - Intergenic
1184130721 22:42515034-42515056 CATGCTGCTCTCAGGGAGCATGG + Intronic
1184140900 22:42576864-42576886 CATGCTGCTCTCAGGGAGCATGG + Intergenic
1184470203 22:44691877-44691899 CTGGCTTCCCTCGTGGAGGAGGG - Intronic
1185203134 22:49520761-49520783 CTTGCTACCCTTATGGGGCACGG - Intronic
949696280 3:6699660-6699682 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696292 3:6699739-6699761 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696305 3:6699818-6699840 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696318 3:6699897-6699919 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696331 3:6699976-6699998 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696344 3:6700055-6700077 CTGGGTGCTTTCATGGACCAGGG - Intergenic
949696357 3:6700134-6700156 CTGGGTGCTTTCATGGACCAGGG - Intergenic
950824871 3:15807908-15807930 TTGGCTACTCATATGGGGCAGGG + Intronic
953096683 3:39783768-39783790 CTGGCTCCTCTCCTGCAGCTGGG + Intergenic
953916828 3:46925754-46925776 CTGTCTACTCTGTTGGAGTACGG + Intronic
954128043 3:48543686-48543708 CTGGCCACCCTCCTGGAGCCAGG - Intronic
955607443 3:60720875-60720897 CTGGCTGCTGTCAAGGAGCCAGG - Intronic
960943104 3:122947336-122947358 TTGGCTCCTCTCAGGGAGGAAGG - Intronic
961599221 3:128046181-128046203 CTGGCTACTGCCATGGAACAAGG - Intergenic
961626012 3:128264294-128264316 GTGGCTACTCTCCTGCAGCATGG + Intronic
964377233 3:156060303-156060325 CTGGCTACACTCAGGGAATAGGG + Intronic
965681819 3:171259634-171259656 CTGGCTAATCTCATGGCCAACGG + Intronic
966329419 3:178794253-178794275 CTAGCTAGTCTCATGGTGCTGGG + Intronic
968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG + Intronic
970397062 4:15679450-15679472 ATTGCTTCTGTCATGGAGCAAGG + Intronic
974390835 4:61265353-61265375 ATGGCAGCTCTCATGGAGCATGG - Intronic
975038405 4:69712706-69712728 CTGGCTTCTCCTATGGAACATGG - Intergenic
975310331 4:72897337-72897359 TTGGCTATTCTGATGGAGGAGGG - Intergenic
978550659 4:109922263-109922285 CTGGTTACTCTAATGAATCATGG + Intronic
985848329 5:2370714-2370736 CTGGGTCCTGTCATGGAGGATGG + Intergenic
986028948 5:3877452-3877474 CTGTCTTCTCACCTGGAGCAAGG - Intergenic
986273702 5:6255716-6255738 CTGGCTCCTCTCCTGGAACCAGG - Intergenic
986300260 5:6472922-6472944 CTGGCAGCTCACATGGAGAAGGG - Intronic
987225081 5:15831683-15831705 CAGGCTGCTCTCATGGAGCATGG + Intronic
989324605 5:40177136-40177158 CTGCCAATTCTCATGGATCAAGG - Intergenic
989436293 5:41417246-41417268 TTGGCTACTATCCTGGAGGAAGG + Intronic
992117705 5:73557574-73557596 CTGGCTACTCGTATCGAACAAGG - Exonic
993078567 5:83267632-83267654 CTGGACAGTCTCAGGGAGCAGGG + Intronic
996342650 5:122455476-122455498 ATGGCTCCTCTCAGGTAGCAGGG + Intronic
998058663 5:139101664-139101686 GTCTCTACTCTCAGGGAGCATGG - Intronic
999198350 5:149798542-149798564 CTGGCTGCTCACAGGCAGCACGG - Intronic
1001089346 5:168725965-168725987 CTGGGGACTCTCATGGCACAGGG + Intronic
1001641895 5:173250219-173250241 CTGGCTACTCCCAGGGAAGAAGG + Intergenic
1002861014 6:1079587-1079609 CTGGCTACTCTCAGAGAGTCAGG + Intergenic
1004971038 6:20910619-20910641 CTGGCTTTTTTGATGGAGCATGG + Intronic
1005199325 6:23325477-23325499 CTGCCCACACTCATGGGGCAGGG - Intergenic
1005844839 6:29769266-29769288 CTGGGTCCTCTTGTGGAGCATGG - Intergenic
1011038967 6:83009949-83009971 TTGTCTACTCTCATGCATCATGG - Intronic
1011254745 6:85408740-85408762 GTGGCTACTCTGAGGGAGCTGGG + Intergenic
1014004596 6:116403748-116403770 CTGACTACTCTCTTGGCCCAAGG + Intronic
1016353772 6:143195614-143195636 CTGGCCACCCTGAGGGAGCACGG + Intronic
1017685169 6:156906165-156906187 CTGGCTGCTCTCAAGAAGCTGGG + Intronic
1019694127 7:2435326-2435348 CTGGGTACTGTCATCCAGCACGG - Intergenic
1026688088 7:72529769-72529791 GTGGCTACTCACATGGAGGAAGG + Intergenic
1026723313 7:72851618-72851640 GTGGCTACTCACATGGAGGAAGG + Intergenic
1030938976 7:115621088-115621110 CTGTCTTCTACCATGGAGCAAGG + Intergenic
1038163386 8:25061674-25061696 CTGGCTAAACTCATACAGCAGGG + Intergenic
1038398295 8:27262967-27262989 CTGGGGACCCTCATGGAGCCTGG + Intergenic
1040522574 8:48191179-48191201 CTGGCTTCTTTAATGGAGCACGG + Intergenic
1042199812 8:66270307-66270329 CTTGCTGCCCTCATGGAGCCTGG - Intergenic
1048974739 8:139664840-139664862 CTGGCTTCATTCCTGGAGCACGG + Intronic
1049275483 8:141718119-141718141 CTGGATCCTCTCCTGGAGGAGGG - Intergenic
1050364167 9:4858879-4858901 CTGGCAAGTCTCATTGGGCAAGG - Intronic
1050703269 9:8365499-8365521 TTGGCTCCTCTCATCGAGCCTGG + Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1052866559 9:33467743-33467765 CTGACCACCCTCCTGGAGCAGGG - Exonic
1053447228 9:38162241-38162263 CTGGCTCCTCCTGTGGAGCAAGG + Intergenic
1053748351 9:41224132-41224154 GTGGCTACTGTAATGGATCAAGG + Intergenic
1054338042 9:63826429-63826451 GTGGCTACTGTAATGGATCAAGG - Intergenic
1056207962 9:84338635-84338657 CTGGCTGCTCCCAGGGAGGAGGG - Intronic
1056785910 9:89592368-89592390 CTGCCTTCTGTCATAGAGCAGGG - Intergenic
1057690954 9:97284593-97284615 CAGGCTTCTTTCATGTAGCAAGG + Intergenic
1057991553 9:99776008-99776030 CAGGGTATTCTCCTGGAGCAGGG - Intergenic
1061997448 9:134193659-134193681 CTGGCTCTGCTCATGGGGCAAGG - Intergenic
1202784481 9_KI270718v1_random:34844-34866 GTGGCTACTGTAATGGATCAAGG + Intergenic
1185563129 X:1075991-1076013 CTGGCACCTCTCAGTGAGCATGG - Intergenic
1185933412 X:4228773-4228795 CTGGCTGGTCTCATGGAGCTTGG + Intergenic
1187142375 X:16606342-16606364 CTCACTAATCTCATGGAGCTGGG + Intronic
1187362894 X:18644589-18644611 CTGGCTACTGTCCTGGAACTTGG + Exonic
1189091369 X:38086182-38086204 CTGGCCCTTCTCATGGAACATGG - Intronic
1190635386 X:52427602-52427624 CTGGCGAATCTCATGTAGCGTGG - Intergenic
1195512004 X:105726706-105726728 CTGGGTTCTCTTATGGGGCAAGG - Intronic
1198217175 X:134566282-134566304 CTGGCTACTCTCATGGAGCAGGG + Exonic
1201057180 Y:10006441-10006463 CTGGTTATTCTCCTGGAGAATGG + Intergenic
1201151091 Y:11096052-11096074 CTGAGTGCTCTCATGGAGCCTGG - Intergenic