ID: 1198217620

View in Genome Browser
Species Human (GRCh38)
Location X:134570255-134570277
Sequence CTCTAGTTATTGGGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198217612_1198217620 2 Left 1198217612 X:134570230-134570252 CCGAACAAGGGAGGGAGAAAGTG 0: 1
1: 0
2: 0
3: 27
4: 305
Right 1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 123
1198217611_1198217620 3 Left 1198217611 X:134570229-134570251 CCCGAACAAGGGAGGGAGAAAGT 0: 1
1: 0
2: 1
3: 27
4: 346
Right 1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198217620 Original CRISPR CTCTAGTTATTGGGGGCAGA GGG Intronic
905240481 1:36577747-36577769 CTCTGGTGGGTGGGGGCAGAGGG + Intergenic
908643369 1:66249677-66249699 CTAAAGTTACTGGGGGCAGGGGG - Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
909184405 1:72467428-72467450 CTTTACTTATTTGAGGCAGAGGG - Intergenic
910763601 1:90759002-90759024 CTCTAGTTCTTGATGGCTGATGG - Intergenic
920054635 1:203183253-203183275 CTCCAGTTACCAGGGGCAGAAGG - Intronic
1063071090 10:2664963-2664985 GTCTTGTTACTGGGGGCAGGTGG - Intergenic
1063541513 10:6938848-6938870 AACCAGTTCTTGGGGGCAGAAGG - Intergenic
1063718879 10:8558346-8558368 TTCTAGTTATGGGGGGCAAGTGG - Intergenic
1069043362 10:63717826-63717848 CTCTGGGCATTGGGGGCAGGGGG - Intergenic
1070505856 10:77112080-77112102 CTATAGTTATTGCAGACAGAAGG + Intronic
1075930939 10:126295162-126295184 TTCTATTTTTTGGGGGGAGAGGG - Intronic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1077209837 11:1364833-1364855 CTCTAGGTATTTTGGGTAGAAGG + Intergenic
1077917560 11:6621457-6621479 CTTTATTTATTGGGGGTAGGGGG - Exonic
1078338746 11:10484239-10484261 CTATAGTGGTTGGGGGCAGATGG + Intronic
1084205047 11:67586324-67586346 CTGGAGGAATTGGGGGCAGAGGG - Intronic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1085527552 11:77173034-77173056 CCCTATTTATTGGAGGCAGCAGG + Intronic
1087754815 11:102044028-102044050 CTAAAGTAATTGGGGGCAGCTGG + Intergenic
1089306601 11:117530255-117530277 CTCTAGCTTTTGGGGGCACTAGG - Intronic
1090681823 11:129067784-129067806 CTCCAGTTGTCTGGGGCAGATGG - Intronic
1092514342 12:9192983-9193005 CTCTAGTTCTGAGGGGCAGGAGG - Intronic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1095672099 12:44874669-44874691 CTCTTGTTATTGGTGGATGAAGG + Intronic
1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG + Intergenic
1099002629 12:77198018-77198040 CTCTAAGTATTGGGAGCAGCAGG - Intergenic
1101756553 12:107625552-107625574 GTCTAGTTATTGGGGGTAGGTGG + Intronic
1104843239 12:131834503-131834525 CTGTAGGTACTGGGGGCAGGGGG + Intronic
1106151359 13:27106380-27106402 CTCTAGTAATTGGGGCGAGACGG + Intronic
1106436694 13:29729575-29729597 CTGATGTTTTTGGGGGCAGAGGG + Intergenic
1106601663 13:31192716-31192738 CTCTAATGATTGGGGGTAAAAGG + Intergenic
1108007589 13:45966910-45966932 GTCTAGTAAATGGGGGCTGAAGG + Intronic
1109529801 13:63627106-63627128 CTCTAGCTATAGGCAGCAGATGG + Intergenic
1109643148 13:65218373-65218395 GGCTAGTTATTGGTGGCATAAGG - Intergenic
1110078635 13:71282709-71282731 CTCCAGTTCTTGGGGGTGGAGGG + Intergenic
1113109195 13:106803522-106803544 GCCTAGTTATTGGGGGAAGTGGG + Intergenic
1117257749 14:53997207-53997229 ATGTAGTTTTTGGGGTCAGAAGG + Intergenic
1120030415 14:79634686-79634708 GCATAGTTGTTGGGGGCAGATGG - Intronic
1121859523 14:97303569-97303591 AACTAGATATTGGGGGCAGTGGG - Intergenic
1127104580 15:55599401-55599423 CTTTGGTTATTGGTTGCAGAGGG - Intergenic
1129527733 15:76232152-76232174 TTGTAATTATTGAGGGCAGAGGG - Intronic
1130612649 15:85375659-85375681 TTTTATTTCTTGGGGGCAGAGGG - Intergenic
1132920835 16:2391226-2391248 CTCATGTTATTTGGTGCAGAAGG - Intergenic
1135667282 16:24346621-24346643 CTCTGGTTGTTGGGGGCTGTAGG - Intronic
1137754643 16:50891730-50891752 CTCTAGAAACTGGGAGCAGAGGG + Intergenic
1138145913 16:54611770-54611792 CTCTGCTTCTTGGGGGCAGTGGG + Intergenic
1139439699 16:66959974-66959996 CACTAGTTATTTTTGGCAGAAGG + Intergenic
1139814981 16:69662290-69662312 CTGTAGTAATTCTGGGCAGAGGG + Intronic
1141610756 16:85179913-85179935 CTCTGGAAAATGGGGGCAGATGG + Intronic
1143778640 17:9217291-9217313 CTCTAGTAATTAAAGGCAGATGG - Intronic
1146206461 17:30909169-30909191 AGCTAGTTTTTGGGGGAAGACGG - Intronic
1149132554 17:53322437-53322459 CTATGGATATTGGGGGCAGAAGG + Intergenic
1151531952 17:74712352-74712374 TTCTAGGCATTTGGGGCAGAAGG - Intronic
1152494613 17:80662224-80662246 CTCTGGTGATAGGAGGCAGAAGG - Intronic
1154400288 18:14030554-14030576 CTGTTTTTATTGGGGGCAGGTGG + Intergenic
1155275815 18:24186503-24186525 CTCTAGGAGTTGGGGGCATATGG + Intronic
1156030184 18:32704269-32704291 CCCAAGTTATTGAGGGCAGAAGG + Intronic
1161009953 19:1955204-1955226 CTCTTGTTTGTGGGGGCAGGGGG + Intronic
1165052072 19:33148107-33148129 CCCTGGTTCTTGGGGGCACATGG - Intronic
1166043245 19:40215398-40215420 CTCTATTTATTGGGGAAGGAGGG + Exonic
1166105837 19:40597641-40597663 CTCTAGTTTATTGGGGCAGGGGG + Intronic
928147100 2:28788848-28788870 TTCTTTTTTTTGGGGGCAGACGG + Intronic
930100821 2:47601491-47601513 CTCTAGGCCTTGGGGGCAGCAGG - Intergenic
931193666 2:60029261-60029283 CTCTTGTTTTTGATGGCAGAAGG - Intergenic
932436453 2:71704969-71704991 CTGCAGTGATTGGGAGCAGATGG + Intergenic
933395984 2:81731857-81731879 CACTAGGTATAGGGGGCAGAGGG - Intergenic
933420961 2:82044144-82044166 CTCTAGGCATTGTGGGAAGAGGG - Intergenic
940795383 2:158071796-158071818 TTTTAGTTATTTGGGGCTGAAGG - Intronic
944446865 2:199800983-199801005 TTCTAGTTATTGGCAGCACAAGG - Intronic
948116641 2:235498313-235498335 CTCTAGTGATTTGGGGGTGAAGG - Intronic
948283803 2:236768985-236769007 CTCTAGATGGCGGGGGCAGAAGG + Intergenic
1175359623 20:58398542-58398564 CTCTAGGTATTGGGAGACGAGGG + Intronic
1179344866 21:40546956-40546978 CCCCAGTTATTGGGGGCAAGGGG + Intronic
1182115769 22:27755416-27755438 CTCTGGTTCTTGGGGACTGATGG + Intronic
1182579430 22:31296245-31296267 CTCCATTTATTGGGGCAAGATGG + Intergenic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1182896112 22:33860802-33860824 TTCTAGTTGTTGTGGGCAGCTGG - Intronic
1184029080 22:41880621-41880643 CTCTGATAATTGGGGGCAGGGGG + Intronic
949845923 3:8370854-8370876 CTCTATGTCTTGGGAGCAGATGG - Intergenic
950018614 3:9770565-9770587 CTAGAGGTATTGGGGGCAGAGGG + Intronic
963834290 3:150040857-150040879 CGCTAGTTTTTGGGGGGAGGGGG - Intronic
966238126 3:177725451-177725473 CTCTAGATATTAGGGACAGAAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969867148 4:10083505-10083527 CTTTATGTTTTGGGGGCAGAGGG + Intronic
975155084 4:71062468-71062490 CTCTAGTTCTTAGGGCAAGAGGG + Intergenic
976892837 4:90071369-90071391 CTCTAGGTATTGGGAGAAGCAGG + Intergenic
978039046 4:104035854-104035876 CTCTAGTTATAGGAGGGAGGTGG + Intergenic
979503046 4:121461649-121461671 TCCTAGTTATTTGGGGAAGAAGG - Intergenic
981936990 4:150249333-150249355 CTCTAGTCCTGAGGGGCAGAGGG + Intronic
984096308 4:175439280-175439302 CTCTACTTCTTGGGCTCAGATGG + Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
993035939 5:82757328-82757350 TTCTAGTTATTGTTGGCATATGG - Intergenic
995945832 5:117644865-117644887 GTCCAGTTATTGGGGGCAGGTGG - Intergenic
997083776 5:130772092-130772114 CTCTTGTTTTTAGGGGGAGAAGG + Intergenic
998545344 5:143022949-143022971 CTCTAGTTCTTTGTGGCTGAGGG + Intronic
1001306863 5:170581186-170581208 CACAAGTTATTGGAGCCAGATGG + Intronic
1003702402 6:8482168-8482190 TTCTAGTTATTTAAGGCAGAAGG + Intergenic
1006105056 6:31711396-31711418 CCCTATTTCTCGGGGGCAGAGGG + Intronic
1007596834 6:43056160-43056182 CTCTGGTTGCTGGGGGCAGCCGG - Exonic
1008040831 6:46796535-46796557 CTCTCTTGATTGGGGGAAGAAGG - Intronic
1012636614 6:101550822-101550844 CTCAACTTATTAGTGGCAGATGG - Intronic
1013173799 6:107660572-107660594 CTCTAGTCAGTGGGGTGAGATGG - Intergenic
1013417885 6:109940755-109940777 CACTTATTGTTGGGGGCAGAGGG - Intergenic
1015657547 6:135536384-135536406 GTTTAGTTATTGAGGTCAGAAGG - Intergenic
1015952024 6:138562815-138562837 CTCTGGTTATGGCGTGCAGAAGG - Intronic
1016403003 6:143700545-143700567 CTCCATTGATTGGGGGCAGTGGG + Intronic
1016813822 6:148285439-148285461 CTCTGGCTATTGGGGGCCCAGGG + Intronic
1019074362 6:169375917-169375939 CTCTAGTTTTTGTGTGTAGAAGG - Intergenic
1020760912 7:12267825-12267847 CTCTATTTAAAGGGGGAAGAGGG - Intergenic
1023517998 7:41021615-41021637 CTCTAGTTCTTGGGGGTGGGGGG - Intergenic
1026880851 7:73905740-73905762 AGCAAGTTATTGGGGACAGACGG - Intergenic
1028601818 7:92609017-92609039 CTCTAGTTCCTGGGAGCAGAGGG + Exonic
1031381111 7:121087094-121087116 CTGTTGTTATTGGGTGGAGAGGG - Intronic
1032392109 7:131562031-131562053 CTCTATTTATTGGGGGGCGGGGG - Intergenic
1032492656 7:132335434-132335456 CTCTAGTGATTTGGGGCAGTGGG - Intronic
1032499333 7:132388291-132388313 TTTTAGTGATTTGGGGCAGAAGG - Intronic
1033450266 7:141456218-141456240 CTCTAGATATTGGGGTAAGAAGG - Intronic
1038623025 8:29162711-29162733 CTTTAGTTTTTGGTGGCAAACGG - Intronic
1038964985 8:32562138-32562160 CTCTTGTTAATGGGGCCAGCTGG - Intronic
1040365492 8:46710934-46710956 CTCCATGTTTTGGGGGCAGAAGG + Intergenic
1041989607 8:63970337-63970359 ATTTAGTTATTGGGGACACATGG - Intergenic
1043193016 8:77250532-77250554 CTCTATTTATCGGGGAGAGAGGG - Intergenic
1048692863 8:136988107-136988129 TGGTAGTTATCGGGGGCAGAAGG - Intergenic
1051174791 9:14350471-14350493 CTATAGGAATTGGGGGCAGCGGG - Intronic
1054475887 9:65572639-65572661 CCCTAGTTATTAGAGGCAGGAGG + Intergenic
1056072822 9:83006766-83006788 CTCTTGTTAGTGGGGCCACAGGG - Intronic
1056119250 9:83471067-83471089 CTCCAGTTTTAGGGGGGAGAAGG + Intronic
1056442735 9:86636834-86636856 CTCTTGTTATCGGAGGCAGCAGG + Intergenic
1061691744 9:132338516-132338538 CTCTAGTTATTGCTGGTAAAAGG - Intronic
1187783292 X:22854281-22854303 CTCTATGTATTGGGAGGAGAGGG + Intergenic
1191687949 X:63911975-63911997 CTCTATTTAATAGAGGCAGAAGG - Intergenic
1196220134 X:113104086-113104108 CTTTATTTATTGGGGTCTGAAGG - Intergenic
1197169947 X:123421678-123421700 TTCCATTTACTGGGGGCAGAGGG + Intronic
1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG + Intronic
1200176756 X:154122410-154122432 CTCTAGTTATTCAGAGCAGAAGG - Intergenic
1200409895 Y:2850810-2850832 CTCTGGTTATCAGGGACAGAGGG + Intronic