ID: 1198217672

View in Genome Browser
Species Human (GRCh38)
Location X:134570624-134570646
Sequence TTGGCTATACAAATGCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198217672_1198217675 -5 Left 1198217672 X:134570624-134570646 CCTAGATGCATTTGTATAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 130
Right 1198217675 X:134570642-134570664 GCCAAGTAGGGCTCAGCTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 128
1198217672_1198217677 27 Left 1198217672 X:134570624-134570646 CCTAGATGCATTTGTATAGCCAA 0: 1
1: 0
2: 1
3: 5
4: 130
Right 1198217677 X:134570674-134570696 TCCTGAACTGAGCTATAGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198217672 Original CRISPR TTGGCTATACAAATGCATCT AGG (reversed) Intronic
901641838 1:10696517-10696539 TGGGGTATACACATGCCTCTGGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906689305 1:47782105-47782127 GTCGCTGGACAAATGCATCTGGG - Intronic
908318816 1:62961339-62961361 TTGGCTATAAAAATGCACCTTGG + Intergenic
910420600 1:87057894-87057916 TAAGCTAAACAAATACATCTGGG + Intronic
911411416 1:97512780-97512802 TTTTCTATACAAATGTATATCGG - Intronic
912757399 1:112335846-112335868 TTGGCTATTCAAATGCCTGGAGG - Intergenic
917592012 1:176486048-176486070 TTGTTTATATAAATTCATCTTGG + Intronic
919083994 1:192899312-192899334 TTTGCCAAACAAATACATCTAGG - Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
924115317 1:240739555-240739577 TTGGAGATTCAAATGCAGCTCGG + Intergenic
1064080890 10:12307172-12307194 TTGGGTATAGAAATGGATCCAGG + Intergenic
1064796013 10:19011917-19011939 AAAGCTATACAAATCCATCTGGG - Intergenic
1065617178 10:27539825-27539847 CTTCCTACACAAATGCATCTAGG - Exonic
1072290943 10:93963783-93963805 TTAGCGGTAAAAATGCATCTAGG - Intergenic
1073850050 10:107604378-107604400 TTGACACTACAAATGCTTCTTGG - Intergenic
1074515656 10:114166674-114166696 GTGGCTATACAAATGAAGGTGGG + Intronic
1074926395 10:118076648-118076670 ATGGCTGTACAAATGTCTCTTGG + Intergenic
1076029425 10:127145030-127145052 TGAGCTTTCCAAATGCATCTTGG + Intronic
1077597980 11:3550817-3550839 TTGGCTTTAAAAATGGATCCAGG - Intergenic
1078725636 11:13928335-13928357 TTGTGTATACATATGCACCTAGG + Intergenic
1084987729 11:72891517-72891539 TTTGCTTTGCAAATGAATCTGGG + Intronic
1085983512 11:81754711-81754733 TTTGTAATAAAAATGCATCTTGG + Intergenic
1090872388 11:130759996-130760018 TTGGCTAGAAAAATGGATTTTGG + Intergenic
1091607343 12:1965863-1965885 CTGACTACACAAATGAATCTAGG + Intronic
1098955280 12:76683032-76683054 TTGGCTAAAGAAATGTGTCTAGG + Intergenic
1099246009 12:80194120-80194142 TTGGCTATACAGGAGTATCTAGG - Intergenic
1099633902 12:85187871-85187893 GAGGCTTTGCAAATGCATCTTGG - Intronic
1106207997 13:27617369-27617391 TCCTCTATCCAAATGCATCTAGG - Intronic
1106879254 13:34111537-34111559 TTGGATAAACAAAAGGATCTGGG - Intergenic
1107689119 13:42934375-42934397 TTGGGTGAACAACTGCATCTGGG + Intronic
1113575903 13:111395238-111395260 CTGGCCATAAAAATGCTTCTTGG + Intergenic
1114235332 14:20818803-20818825 TTTTCTCTTCAAATGCATCTGGG + Intergenic
1118047948 14:61992714-61992736 TTGGAAATTCAAATGCATCCAGG + Intergenic
1118525675 14:66638877-66638899 TTGTCTGAAGAAATGCATCTTGG - Intronic
1119412232 14:74440076-74440098 TTGGCCTTAATAATGCATCTCGG + Intergenic
1121928967 14:97954740-97954762 TTGGCTATGCAAATATTTCTGGG + Intronic
1122538014 14:102479744-102479766 TTGCCTGTACAAGTGCCTCTTGG + Intronic
1131315739 15:91335299-91335321 CCGGCTATAAAAATGCATTTAGG + Intergenic
1133427869 16:5708723-5708745 TGGGCAATAAAAATCCATCTTGG + Intergenic
1134130072 16:11643151-11643173 TTGGCTATTCCAAGGCATCAGGG - Intergenic
1134178593 16:12029257-12029279 TTCACTAAACAAATACATCTTGG + Intronic
1134853018 16:17497374-17497396 TTGTATATGCAAATGCATCCTGG - Intergenic
1135305335 16:21363003-21363025 TTCACTAAACAAATACATCTTGG + Intergenic
1136302078 16:29342155-29342177 TTCACTAAACAAATACATCTTGG + Intergenic
1140054396 16:71512998-71513020 TTAGATATACAATTGCTTCTTGG - Intronic
1149354385 17:55824931-55824953 TTGAGTATACAAATGAATTTGGG + Intronic
1151239768 17:72748804-72748826 TTGGCTAGAGGCATGCATCTGGG - Intronic
1154236459 18:12610587-12610609 TCAGCTATACAAATGCAGGTGGG - Intronic
1157716384 18:49890568-49890590 TTGGGGATACAAATGTAGCTAGG + Intronic
1159374379 18:67573714-67573736 TTGCTTCTACAAATGCCTCTTGG + Intergenic
1164911152 19:32012981-32013003 TTGGTAAAACAACTGCATCTGGG + Intergenic
925121173 2:1419595-1419617 TTTGCCACACAAATGCCTCTGGG - Intronic
925571975 2:5322259-5322281 TTGGATTTACAAAGGCAACTGGG - Intergenic
926282248 2:11459439-11459461 TTGGCTATACTGATGTATGTGGG + Intronic
927473677 2:23396022-23396044 TTGGCAAGACAACTGCAGCTAGG - Intronic
929719334 2:44351400-44351422 TTGGATATACAAGTTCATCTTGG - Intronic
939772590 2:146340282-146340304 TTGGCTATAAAACAACATCTGGG - Intergenic
940291761 2:152084205-152084227 CTGGCTTTACAAAAGAATCTGGG + Intronic
945806261 2:214493534-214493556 TTTGCTACACAAATGCATGGGGG - Intronic
1170452978 20:16505044-16505066 GTGACTATACAAATGCATGTGGG + Intronic
1170583209 20:17714458-17714480 TTGTCTATAAAATTCCATCTAGG - Intronic
1173312172 20:41906412-41906434 TTTATTATACAAATGGATCTTGG + Intergenic
1178542478 21:33465092-33465114 GTTGCTATTCAAATGGATCTTGG - Intronic
1182064857 22:27423496-27423518 TTGCCTATTCAAATGCACATAGG + Intergenic
1183261915 22:36800641-36800663 TTGGCTTTCCAGATGCATCTGGG - Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949759644 3:7455373-7455395 TTGGTTATTCATATGTATCTTGG - Intronic
950406072 3:12805779-12805801 TTGCCTATACAAATGCCCATTGG + Intronic
951387283 3:22058055-22058077 TTGGCTATACACACCCTTCTAGG + Intronic
954011848 3:47647522-47647544 TTTGCTATACAGATGGTTCTTGG - Intronic
955485943 3:59434509-59434531 TTATCTATACAGATGCATATTGG - Intergenic
956111348 3:65872663-65872685 TTTTCTATTCATATGCATCTGGG - Intronic
956272445 3:67462353-67462375 CTGTCTATACAGATGCTTCTTGG - Intronic
956339845 3:68210302-68210324 TTGGCCCTACAGATGCCTCTGGG + Intronic
958839214 3:99183191-99183213 TTTTATACACAAATGCATCTAGG - Intergenic
959783901 3:110269868-110269890 TTGGCTATGTAGTTGCATCTGGG + Intergenic
960778083 3:121284473-121284495 GTAGCCATACAAATGAATCTAGG - Intronic
962100944 3:132341989-132342011 TTGGCTATACATATAAAACTTGG - Intronic
963265940 3:143240059-143240081 GTTGATATACCAATGCATCTTGG - Intergenic
963866580 3:150368432-150368454 TTGGGTATAAAAATCCATCCCGG + Intergenic
964319515 3:155480481-155480503 TGAGTTATAAAAATGCATCTGGG + Exonic
965443260 3:168743055-168743077 CTTGCTAGAAAAATGCATCTTGG + Intergenic
971020117 4:22526571-22526593 TTGGCTCAACAAATGGATTTTGG - Intergenic
976840208 4:89423812-89423834 TTGAATATACACATACATCTAGG - Intergenic
979914042 4:126407209-126407231 TTGGCTATATATATACATTTAGG - Intergenic
981230849 4:142353612-142353634 ATGCATATACAACTGCATCTAGG + Intronic
981677054 4:147354356-147354378 TTGGCTATAAAATTACATTTGGG + Intergenic
984398881 4:179235969-179235991 AAGGCTTTACAAATGCATTTAGG - Intergenic
985608935 5:875645-875667 GTTGCTATAAAAAAGCATCTGGG - Intronic
987779478 5:22415844-22415866 TTGGCAATACAAAAGAGTCTAGG + Intronic
990107568 5:52283457-52283479 TTGGCTACATAAATGAAACTAGG + Intergenic
992437102 5:76765411-76765433 ATGGCTTTAAAAATGAATCTTGG - Intergenic
995382048 5:111546373-111546395 TTGTCTTTACAGATGCACCTTGG + Intergenic
996827563 5:127702772-127702794 CTGGGTCTACAAATGCATCCAGG + Intergenic
996961382 5:129254719-129254741 TTGTCTATACATATCCTTCTAGG + Intergenic
998956586 5:147444924-147444946 TTTGCTTTACAAATGCAGATTGG + Intronic
1003760151 6:9170863-9170885 TTGGAAATCCAAATACATCTGGG - Intergenic
1004941663 6:20564678-20564700 TTTGTTATACAAAAGCAACTAGG - Intronic
1005922441 6:30414747-30414769 CTGACTATACAAATCCATCCTGG - Intergenic
1006054383 6:31371736-31371758 TTGGCTATACAAGTTCTTTTTGG - Intergenic
1007959382 6:45945105-45945127 TTGTCTGTACAATTGCACCTGGG + Intronic
1008145986 6:47891965-47891987 TTGGATATTCAAATCCTTCTGGG - Intronic
1009724900 6:67526010-67526032 TTGTCTATATAAAAGCAACTAGG + Intergenic
1010053193 6:71532395-71532417 TCGGCTATAAAAACGGATCTGGG - Intergenic
1010128730 6:72466193-72466215 ATGGAAATAAAAATGCATCTAGG + Intergenic
1010671144 6:78688130-78688152 TTGCCTAAACCACTGCATCTGGG - Intergenic
1015538675 6:134292705-134292727 TTTCCTATTCAAATGCATTTTGG - Intronic
1017604448 6:156118926-156118948 TTGGATATACAATTTCATTTTGG + Intergenic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1022070253 7:26906164-26906186 ATGGATATAAAAATACATCTTGG + Intronic
1023791150 7:43754807-43754829 TGGGAAACACAAATGCATCTTGG + Intergenic
1027431861 7:78122301-78122323 TAGTCAATACAAAAGCATCTTGG - Intronic
1028813302 7:95114043-95114065 TTGGCCATACAAACACAGCTGGG + Intronic
1029205268 7:98866009-98866031 TGGGCTCTAAAATTGCATCTCGG + Intronic
1036985427 8:13523521-13523543 TGGGCTAGACAAATACATTTGGG + Intergenic
1038031418 8:23645085-23645107 TTGTCTATTCCCATGCATCTAGG + Intergenic
1039187536 8:34933999-34934021 TTGCCTATACAAATGGCTATGGG + Intergenic
1040512905 8:48110958-48110980 TGTGCTATAAAAATGCATCTGGG + Intergenic
1044138897 8:88623142-88623164 TGGGCTATATAAATGCAGATAGG + Intergenic
1048045406 8:130768024-130768046 TTGGTTTTAAAAATGGATCTAGG + Intergenic
1048053109 8:130837892-130837914 TTGGCTATAAAGTGGCATCTAGG + Intronic
1051165405 9:14256974-14256996 TAGGCCATAGAAAGGCATCTTGG - Intronic
1056693885 9:88830096-88830118 TTTGTCATACAAATGCCTCTGGG + Intergenic
1059822039 9:117984191-117984213 ATGCCTATTCAAATGCCTCTTGG + Intergenic
1186233920 X:7486210-7486232 TTGCCTAAAACAATGCATCTAGG - Intergenic
1187495607 X:19792993-19793015 ATGGCTATATAAGAGCATCTGGG + Intronic
1193349343 X:80441576-80441598 TTGTCTAAACAAATAAATCTAGG - Intronic
1194062325 X:89219109-89219131 TTGGTTAAATAAATTCATCTGGG - Intergenic
1195758980 X:108225929-108225951 TTTGCTTTACAAATCCCTCTGGG - Intronic
1196635707 X:118000198-118000220 TTGGCCAAACAAATGCAGCCGGG + Intronic
1197496467 X:127188911-127188933 AAGATTATACAAATGCATCTAGG - Intergenic
1198217672 X:134570624-134570646 TTGGCTATACAAATGCATCTAGG - Intronic
1198813829 X:140565465-140565487 CTAGCTATTCAAATGCCTCTAGG + Intergenic
1199641369 X:149865723-149865745 TTGGATAAACAATTGCATCAAGG - Intergenic
1200716192 Y:6548075-6548097 TTGGTTAAATAAATTCATCTGGG - Intergenic