ID: 1198217885

View in Genome Browser
Species Human (GRCh38)
Location X:134573425-134573447
Sequence TCTCAACTCCACGGCAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198217880_1198217885 22 Left 1198217880 X:134573380-134573402 CCTTCTCATTTTAAAAGACAAGG 0: 1
1: 0
2: 2
3: 36
4: 487
Right 1198217885 X:134573425-134573447 TCTCAACTCCACGGCAGCCACGG 0: 1
1: 0
2: 0
3: 22
4: 422
1198217879_1198217885 23 Left 1198217879 X:134573379-134573401 CCCTTCTCATTTTAAAAGACAAG 0: 1
1: 0
2: 2
3: 68
4: 691
Right 1198217885 X:134573425-134573447 TCTCAACTCCACGGCAGCCACGG 0: 1
1: 0
2: 0
3: 22
4: 422
1198217878_1198217885 30 Left 1198217878 X:134573372-134573394 CCAGAGTCCCTTCTCATTTTAAA 0: 1
1: 0
2: 1
3: 25
4: 287
Right 1198217885 X:134573425-134573447 TCTCAACTCCACGGCAGCCACGG 0: 1
1: 0
2: 0
3: 22
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198217885 Original CRISPR TCTCAACTCCACGGCAGCCA CGG Intronic
900982331 1:6053352-6053374 CCCCAACCTCACGGCAGCCATGG + Intronic
901227734 1:7624119-7624141 TCTCAGCTTCAAGGCAGCCGTGG + Intronic
901728981 1:11264396-11264418 TCTCCACTGCACTGCAGCCTGGG + Intergenic
905248101 1:36628687-36628709 TCTCAGCTCGATGGCAGCCACGG + Intergenic
906209053 1:44002234-44002256 TCTCAGCTCCAGTGCAGCCATGG - Intronic
906890547 1:49708590-49708612 TCACAACTCCTCGCCAGCAAGGG - Intronic
907015309 1:51006329-51006351 TCACAACTCCTCGCCAGCAAGGG + Intergenic
908147267 1:61259867-61259889 TCTCAACTGCACGGCAACAATGG - Intronic
908733220 1:67248648-67248670 TCACAACTCCTCGCCAGCAAGGG - Intronic
908903968 1:68986479-68986501 TCTCAACTCCTCTCCAGCAAGGG + Intergenic
910799657 1:91132332-91132354 TCACAACTCCTCGCCAGCAAGGG + Intergenic
911217855 1:95215725-95215747 TCACAACTCCTCGCCAGCAAGGG - Intronic
911632790 1:100201013-100201035 TCACAACTCCTCGCCAGCAAGGG + Intronic
912252802 1:108028816-108028838 TCTCAACTAACTGGCAGCCAGGG - Intergenic
912270903 1:108208461-108208483 TCACAACTCCTCGCCAGCAAGGG - Intergenic
915807101 1:158865416-158865438 TGTCAACTCCTCGCCAGCAAGGG + Intergenic
916359682 1:163953640-163953662 TCACAACTCCTCGCCAGCAAGGG + Intergenic
916362969 1:163991240-163991262 TCACAACTCCTCGCCAGCAAGGG + Intergenic
916916228 1:169408992-169409014 TCACAACTCCTCGCCAGCAAGGG + Intronic
917248439 1:173030610-173030632 TCACAACTCCTCGCCAGCAAGGG + Intergenic
917915354 1:179695447-179695469 TCTCAACTCCTCTCCAGCAAGGG + Intergenic
918124973 1:181575246-181575268 TCCCAACCACACTGCAGCCAGGG - Intronic
918353642 1:183684204-183684226 TCACAACTCCTCGCCAGCAAGGG - Intronic
918612701 1:186511447-186511469 TCACAACTCCTCGCCAGCAAAGG - Intergenic
920432388 1:205927355-205927377 TCTCCACTCCACCAAAGCCATGG - Intronic
921162878 1:212485502-212485524 CCTCACCTGCAGGGCAGCCATGG - Intergenic
921484735 1:215702850-215702872 TCACAACTCCTCGCCAGCAAGGG - Intronic
923690774 1:236191378-236191400 TCACAACTCCTCGCCAGCAAGGG - Intronic
923853566 1:237821628-237821650 TCACAACTCCTCGCCAGCAAGGG + Intronic
924631522 1:245745273-245745295 TCACAACTCCTCGCCAGCAAGGG - Intergenic
924828901 1:247572237-247572259 TCACAACTCCTCGCCAGCAAGGG - Intronic
924834413 1:247634744-247634766 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1065770437 10:29073201-29073223 TCTCTAACCCACTGCAGCCATGG - Intergenic
1066159797 10:32715504-32715526 TCACAACTCCTCGTCAGCAAGGG + Intronic
1067195641 10:44115566-44115588 TCTCACCTGCACAGCAGACAGGG - Intergenic
1068427291 10:56883438-56883460 TCACAACTCCACGCCAGCAAGGG + Intergenic
1068469828 10:57447514-57447536 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1069264169 10:66437738-66437760 TCACAACTCCTCGCCAGCAAGGG - Intronic
1071190191 10:83090279-83090301 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1072935613 10:99710144-99710166 TCTCCACTCCAAGGCAGCCCTGG + Intronic
1073293229 10:102423651-102423673 TCTCACCTCCTTGGGAGCCATGG + Exonic
1073510339 10:104038800-104038822 TCTCAACTCCCCAGCACCCTGGG + Intronic
1074795379 10:116938201-116938223 TCACAACTCCTCGCCAGCAAGGG - Intronic
1076257023 10:129035511-129035533 TCTGAACTCCAAGGCAGCCCAGG - Intergenic
1076601907 10:131662809-131662831 TCCCAACACCACAGCAGCAAGGG - Intergenic
1077844754 11:6012835-6012857 TCCAAAGTCCAGGGCAGCCAAGG + Intergenic
1078120603 11:8504988-8505010 TCCCAACTCCACAGCAGTGATGG + Intronic
1079262432 11:18896640-18896662 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1079332615 11:19546296-19546318 TCTCAGTTACAAGGCAGCCAGGG - Intronic
1079868030 11:25759403-25759425 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1081775762 11:45675014-45675036 TGTCAACCACAGGGCAGCCAGGG + Intergenic
1082182704 11:49139762-49139784 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1083496984 11:63064082-63064104 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1083510345 11:63203260-63203282 TCACAACTCCTTGGCAGCAAGGG + Intronic
1083547217 11:63558005-63558027 TCTCTAGTCCATGTCAGCCATGG - Intronic
1084148350 11:67276711-67276733 TCTCCAGCCCCCGGCAGCCACGG + Intronic
1086732696 11:90270098-90270120 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1086789619 11:91019100-91019122 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1086907010 11:92430369-92430391 TCACAACTCCTCGCCAGCAAGGG - Intronic
1087335228 11:96835702-96835724 TCTGAATTCCAGTGCAGCCATGG + Intergenic
1087596249 11:100257894-100257916 TCACAACTCCTCGCCAGCAAGGG + Intronic
1087830854 11:102818927-102818949 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1087925263 11:103911582-103911604 TCACAACTCCTCGCCAGCAAGGG + Intronic
1089285348 11:117404190-117404212 TCACAACTCCTCGCCAGCAAGGG - Intronic
1089765907 11:120765495-120765517 TCACAACTCCTCGTCAGCAAGGG - Intronic
1092639019 12:10482781-10482803 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1093335919 12:17905108-17905130 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1093835482 12:23824153-23824175 TCACAACTCCTCGCCAGCAAGGG - Intronic
1095356547 12:41281320-41281342 TCACAACTCCTCGCCAGCAAGGG + Intronic
1095547233 12:43387024-43387046 TCACAACTCCTCGCCAGCAAAGG - Intronic
1095674360 12:44898710-44898732 TCACAACTCCTCGCCAGCAAGGG + Intronic
1095779008 12:46037957-46037979 TCACAACTCCTCGACAGCAAAGG + Intergenic
1096459031 12:51811816-51811838 TCTCACCTCCACAGCAGGCCTGG - Exonic
1098228251 12:68346822-68346844 TCCCCACACCAAGGCAGCCAGGG + Intergenic
1098438655 12:70496253-70496275 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1098463349 12:70758738-70758760 TCTCTTCTCCAAGGCACCCATGG + Intronic
1098957353 12:76701470-76701492 TCTTCACTGCACTGCAGCCAGGG + Intergenic
1099744854 12:86689379-86689401 TCACAACTCTTCGCCAGCCAGGG - Intronic
1099998025 12:89800556-89800578 TATCAACTCCACAGTATCCATGG - Intergenic
1100073798 12:90754519-90754541 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1103871897 12:124098282-124098304 TCTTAGCTCCAGTGCAGCCACGG - Intronic
1103937257 12:124483254-124483276 TCTCTGCTCCACGGCACCCCAGG + Intronic
1105672569 13:22636111-22636133 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1106377311 13:29202543-29202565 TCACAACTCCTCGCCAGCAAGGG - Intronic
1106426460 13:29635692-29635714 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1106429553 13:29666680-29666702 TCACAACTCCTCGCCAGCAATGG + Intergenic
1107145923 13:37060188-37060210 TCTCCACTCCACTCCAGCCTGGG - Intergenic
1107289695 13:38838995-38839017 TCACAACTCCTCGCCAGCAAGGG - Intronic
1107660107 13:42630478-42630500 TCTCAATTTCAAGGCAGGCAGGG - Intergenic
1107968723 13:45621402-45621424 TCACAACTCCTTGCCAGCCAGGG - Intergenic
1108217821 13:48201963-48201985 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1108236960 13:48417532-48417554 TCACAACTCCTCGCCAGCAAGGG + Intronic
1109661504 13:65466647-65466669 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1114433927 14:22687093-22687115 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1114710192 14:24769556-24769578 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1115359677 14:32487579-32487601 TCACAACTCCTCGCCAGCAAGGG - Intronic
1115538185 14:34392618-34392640 TCACAACTCCTCGCCAGCAAGGG + Intronic
1115720968 14:36161257-36161279 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1115986795 14:39110611-39110633 TCGCAACTACACTGCAGCCTGGG + Intergenic
1116009310 14:39332478-39332500 TCACAACTCCTTGGCAGCAAGGG - Intronic
1116511769 14:45755645-45755667 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1117299121 14:54406877-54406899 TCACAACTCCTCGCCAGCAAGGG - Intronic
1117710824 14:58526659-58526681 TCACAACTCCTCGCCAGCAAGGG + Intronic
1117796934 14:59404752-59404774 TCACAACTCCTCGCCAGCAATGG - Intergenic
1118498577 14:66333851-66333873 TCACAACTCCTCGCCAGCCAGGG + Intergenic
1118515958 14:66529501-66529523 TCACAACTCCTCGCCAGCAAGGG - Intronic
1118709776 14:68509764-68509786 CCACAACTGCAAGGCAGCCATGG + Intronic
1119018346 14:71083886-71083908 TCACAACTCCTCGCCAGCAAGGG - Intronic
1123006466 14:105326223-105326245 TCTCAACTCCACTGCTGCGGGGG - Intronic
1123139538 14:106061844-106061866 CCTCAGCTCCACAGAAGCCAGGG - Intergenic
1123144569 14:106116330-106116352 CCTCAGCTCCACAGAAGCCAGGG - Intergenic
1202880486 14_KI270722v1_random:54289-54311 TCACAACTCCCCGCCAGCAAGGG + Intergenic
1123397883 15:19955332-19955354 GCTCAGCTCCACGGCTGCCCAGG - Intergenic
1124084325 15:26532460-26532482 TCACAACTCCATGCCAGCAAGGG + Intergenic
1124666848 15:31599594-31599616 TCACAACTCCTCGCCAGCAAGGG + Intronic
1124694020 15:31848320-31848342 TCTCAATCCCACAGCAGTCATGG - Intronic
1125354422 15:38802504-38802526 TCACAACTCCTCAGCAGCAAGGG - Intergenic
1125528977 15:40398850-40398872 TCTCAACTGCACTCCAGCCTAGG + Intergenic
1125984856 15:44039779-44039801 TCACAACTCCTCGCCAGCAAGGG + Intronic
1126470638 15:49006831-49006853 TCACAACTCCTCGCCAGCAAGGG - Intronic
1126720198 15:51569895-51569917 TCACAACTCCTCGCCAGCAAGGG + Intronic
1128560763 15:68666437-68666459 TCTGAACTCCACAGGACCCAGGG + Intronic
1131061570 15:89407788-89407810 TCCCAGCTCCACGGCGGCCGCGG + Intergenic
1133087111 16:3373434-3373456 TCTCAGCACCACAGCTGCCAGGG - Intronic
1133128657 16:3663005-3663027 TCCCAACTCCCCGGCTTCCATGG + Exonic
1133366574 16:5215048-5215070 TCTCCACTGCACTGCAGCCTGGG + Intergenic
1135733858 16:24915633-24915655 TCTCTACTCCACAGAATCCACGG + Intergenic
1136694630 16:32066637-32066659 CCTCACCTCCACAGAAGCCAGGG + Intergenic
1136795132 16:33009899-33009921 CCTCACCTCCACAGAAGCCAGGG + Intergenic
1136874784 16:33844483-33844505 CCTCACCTCCACAGAAGCCAGGG - Intergenic
1137593170 16:49706344-49706366 TCTCACCTCCAGGCCAGCCATGG + Intronic
1140716680 16:77732867-77732889 GTTCAACTCCAAGGCAGCCAGGG - Intronic
1141492334 16:84382556-84382578 GCTCAACACCATTGCAGCCAGGG + Intronic
1141572350 16:84941600-84941622 GCTCAACTCCCCGACAGCCCTGG + Intergenic
1141885293 16:86887765-86887787 TGACAACTCCATGTCAGCCAAGG + Intergenic
1143771755 17:9173519-9173541 CCTGACCTCCACAGCAGCCAGGG + Intronic
1143996417 17:11010344-11010366 TCTCTACTCCAAGGTGGCCATGG + Intergenic
1144837052 17:18161975-18161997 TATCTCCTCCACGGCTGCCATGG - Intronic
1144888507 17:18479705-18479727 TCTAAATTCCACAGCAGCCTTGG + Intronic
1144950300 17:18990303-18990325 TCTCAACACCACTGCCTCCAGGG - Intronic
1145143699 17:20464597-20464619 TCTAAATTCCACAGCAGCCTTGG - Intronic
1145242805 17:21249530-21249552 TCTTAGCTCCACTGCATCCAGGG + Intronic
1146825810 17:36022570-36022592 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1148006641 17:44436737-44436759 TCCCAACTGGACGTCAGCCAAGG - Intronic
1148967519 17:51448091-51448113 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1149637645 17:58183602-58183624 TCCCAACCCCTCGGCAGCCCTGG - Intergenic
1151239861 17:72749363-72749385 TCCAAAGTCCACGGCAGGCAGGG + Intronic
1151555807 17:74846198-74846220 CCTCAACTACATGGCAGGCAAGG - Exonic
1152252420 17:79218968-79218990 TCCCTTCTCCACGGCTGCCATGG + Intronic
1153313292 18:3699180-3699202 TCACAACTCCTCGCCAGCAAGGG - Intronic
1153562119 18:6382369-6382391 TCACAACTCCTCGCCAGCAAGGG - Intronic
1154382109 18:13862297-13862319 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1155006812 18:21736469-21736491 TCACAACTCCTCGCCAGCAAGGG + Intronic
1155540633 18:26864645-26864667 TCTGAACTCACCGGCAGCCCAGG + Intronic
1155665059 18:28298554-28298576 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1156421728 18:36960919-36960941 TCGCAACTCCTCGCCAGCAATGG + Intronic
1156474055 18:37394661-37394683 CCTCCACTCCACTGCAGACATGG + Intronic
1157071874 18:44417326-44417348 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1157149329 18:45200010-45200032 TCTCAACTCCCTGGTGGCCATGG + Intergenic
1157178739 18:45477019-45477041 TCACAACTCCCCGCCAGCAAGGG - Intronic
1157520055 18:48339261-48339283 TCTCAGCTCCACCCCAACCATGG + Intronic
1158373296 18:56832941-56832963 TCACAACTCCTCGCCAGCAAGGG + Intronic
1159945907 18:74444764-74444786 TCTTACCTCCACTGCAGCCTTGG - Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160486748 18:79300186-79300208 TCTCAACCCCACTTCAGACATGG - Intronic
1161071701 19:2265499-2265521 TCTCAACTGCACTGCAGCCTGGG - Intronic
1161162554 19:2769198-2769220 TCTCAGCTCCAGGACAGCCCAGG + Intronic
1163437534 19:17304177-17304199 TCTCAGAACCATGGCAGCCATGG - Intronic
1163645185 19:18485264-18485286 TCTCAACTCCCCTGCAGACAAGG + Intronic
1165127863 19:33613489-33613511 TTTCAACTCCAGGGCATCCCAGG + Intergenic
1165409350 19:35649360-35649382 TCTCCACTGCACGCCAGCCTGGG - Intronic
1165812518 19:38620111-38620133 TCTAAACTCCACTGGAGCCCTGG - Intronic
1165845413 19:38815165-38815187 CCTCAACCCCAGGGCAGGCAGGG + Intergenic
1167818377 19:51904419-51904441 TCACAACTCAACCCCAGCCAGGG + Intronic
1202656095 1_KI270708v1_random:23391-23413 TCACAACTCCCCGCCAGCAAGGG + Intergenic
924967751 2:93396-93418 TCACAACTCCTCGCCAGCAAGGG + Intergenic
925507009 2:4577759-4577781 TCACAACTCCAAGGCATCCCAGG + Intergenic
926533665 2:14083189-14083211 TCACAACTCCTCGCCAGCAAGGG + Intergenic
926606908 2:14907120-14907142 TTTCTACCCCACAGCAGCCAGGG - Intergenic
926912984 2:17868697-17868719 TCTGGAATCCACGGCAGCAATGG - Intergenic
927021198 2:19019594-19019616 TCACAACTCCTCGCCAGCAAGGG - Intergenic
927246808 2:20963163-20963185 TCTATACTTCACTGCAGCCACGG + Intergenic
927853742 2:26515301-26515323 TGTCTACTCCAGGCCAGCCACGG - Intronic
928222134 2:29412814-29412836 TCTCAGCACCATGGCAACCATGG - Intronic
928750784 2:34467612-34467634 TCACAACTCCTCGCCAGCAAGGG + Intergenic
929257613 2:39830012-39830034 TCACAACTCCATGCCAGCAAGGG - Intergenic
929812893 2:45206605-45206627 TCTGAACACCCAGGCAGCCAAGG - Intergenic
929838144 2:45426953-45426975 TCACAACTCCTCGCCAGCAAGGG + Intronic
930860226 2:56064587-56064609 TCACAACTCCTCGTCAGCAAGGG - Intergenic
931030506 2:58169506-58169528 TCACAACTCCTCGCCAGCAAGGG + Intronic
931479012 2:62621422-62621444 TCACAACTCCTCGCCAGCAAGGG - Intergenic
933094537 2:78161848-78161870 TCACAACTCCTCGCCAGCAAGGG - Intergenic
933355756 2:81207092-81207114 TCACAACTCCTCGCCAGCAAGGG + Intergenic
934871941 2:97873825-97873847 TCACAACTCCTCGCCAGCAAGGG + Intronic
935325954 2:101936764-101936786 TCACAACTGCTCGCCAGCCAGGG + Intergenic
936146109 2:109981532-109981554 TACCACCTCCACGGCAGTCAGGG - Intergenic
936198581 2:110389947-110389969 TACCACCTCCACGGCAGTCAGGG + Intergenic
936448201 2:112614018-112614040 TCGCAACTCCTCGCCAGCAAGGG - Intergenic
936640150 2:114303352-114303374 TCACAACTCCTCGTCAGCAAGGG - Intergenic
937354282 2:121188186-121188208 TCTGAAGTCCTGGGCAGCCAAGG - Intergenic
937807416 2:126161879-126161901 TCACAACTCCTCGCCAGCAAGGG + Intergenic
939116782 2:138070374-138070396 TCACAACTCCTCGCCAGCAAGGG - Intergenic
939950633 2:148468577-148468599 TCTCCATTCCGTGGCAGCCATGG + Exonic
940593877 2:155766137-155766159 TCACAACTCCTCGCCAGCAAGGG - Intergenic
940602722 2:155881311-155881333 TCACAACTCCTCGCCAGCAAAGG + Intergenic
942010743 2:171760550-171760572 TCACAACTCCTCGCCAGCAAGGG - Intergenic
942435756 2:175973746-175973768 TGTCAACTCAACAACAGCCAAGG + Intronic
943352610 2:186812964-186812986 TCACAACTCCTCGCCAGCAAGGG + Intergenic
943552357 2:189356771-189356793 TCACAACTCCTCGCCAGCAAGGG - Intergenic
943599019 2:189892270-189892292 TCACAACTCCTCGCCAGCAAGGG - Intronic
944169307 2:196757655-196757677 TCACAACTCCTCGCCAGCAAGGG - Intronic
944268032 2:197749342-197749364 TCACAACTCCTCGCCAGCAAGGG + Intronic
945389121 2:209242534-209242556 TCTCAACTCCTTGCCAGCAAGGG + Intergenic
946790097 2:223292666-223292688 TCACAACTCCTCGCCAGCAAGGG - Intergenic
947099109 2:226600319-226600341 TTTCCACCCCACGGCAGCCGTGG - Intergenic
947492244 2:230604749-230604771 TCACAACTCCTCACCAGCCAGGG + Intergenic
947524807 2:230871542-230871564 TGTCATCTCCTCAGCAGCCAGGG - Intronic
947733674 2:232444142-232444164 ACTCCACCCCACAGCAGCCAAGG - Intergenic
947933085 2:233980427-233980449 ACTCAACTTCACGACAACCAAGG - Intronic
948471124 2:238180210-238180232 TGCCAAGTCCACGGCAGACATGG + Intronic
949058248 2:241941601-241941623 GCTCAAATCCACTGCAGCCAAGG - Intergenic
1169176769 20:3523018-3523040 TCACAACTCCTCGCCAGCAAGGG + Intronic
1169319918 20:4624356-4624378 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1169396924 20:5240780-5240802 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1170134047 20:13053493-13053515 TCACAACTCCTCGCCAGCAAGGG + Intronic
1170229265 20:14027497-14027519 TCACAACTCCTCGTCAGCAAGGG - Intronic
1172006134 20:31820109-31820131 TCTCACCTCCTCTGCAGACAAGG + Exonic
1173771687 20:45665453-45665475 TCGCAGCTCCTCGGCAGCAATGG - Intronic
1174131144 20:48344107-48344129 TCTCAACTCCAAGGGACCCTTGG - Intergenic
1176511709 21:7753524-7753546 TCTCGGCTCCACCGCAGTCAGGG + Intronic
1176641813 21:9311840-9311862 TCACAACTCCCCGCCAGCAAGGG + Intergenic
1177426004 21:20923200-20923222 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1178645822 21:34384051-34384073 TCTCGGCTCCACCGCAGTCAGGG + Intronic
1179312888 21:40212417-40212439 TCTAAACACCATGGCAGCCCTGG + Intronic
1180350828 22:11801192-11801214 TCACAACTCCCCGCCAGCAAGGG + Intergenic
1180387380 22:12190878-12190900 TCACAACTCCCCGCCAGCAAGGG - Intergenic
1181852072 22:25756530-25756552 TCATAACTTAACGGCAGCCATGG - Intronic
1185115803 22:48937009-48937031 TCTCCACCCCAAGCCAGCCATGG - Intergenic
949173748 3:1034161-1034183 TCACAACTCCTCGCCAGCAAGGG - Intergenic
949683276 3:6540525-6540547 TCACAACTCCTCGCCAGCAAGGG - Intergenic
950619572 3:14193815-14193837 TCACAACTCCTCGCCAGCAAGGG - Intronic
951237590 3:20253721-20253743 TCACAACTCCTCGCCAGCAAGGG - Intergenic
951415011 3:22413592-22413614 TCGCAACTCCTCGCCAGCAAGGG - Intergenic
951503536 3:23417087-23417109 TCACAACTCCTCGCCAGCAAGGG - Intronic
951676311 3:25246357-25246379 TCACAACTCCTCGCCAGCAAGGG - Intronic
951687471 3:25361518-25361540 TCACAACTCCTTGGCAGCAAGGG - Intronic
952958426 3:38575113-38575135 TCTCAACCCCACGGCACGTATGG - Intronic
953102217 3:39841490-39841512 TCACAACTCCTCGCCAGCAAGGG - Intronic
953315991 3:41926452-41926474 TCACAACTCCTCGCCAGCAAAGG + Intronic
953895044 3:46791051-46791073 TCACAACTCCTCGCCAGCAAGGG + Intronic
956032559 3:65054825-65054847 TCTCAGCTCCTCGCCAGCAATGG + Intergenic
957098319 3:75798815-75798837 TCACAACTCCCCGCCAGCAAGGG - Intergenic
958793709 3:98682974-98682996 TCACAACTCCTCGCCAGCAAGGG + Intergenic
960552566 3:118992671-118992693 TTTCAACACCAAGGTAGCCATGG - Intronic
962180975 3:133206336-133206358 TCACAACTCCTCGCCAGCAAGGG - Intronic
962645216 3:137431610-137431632 TCACAACTCCTCGCCAGCAATGG + Intergenic
963262543 3:143207326-143207348 TCTCAAGAGCCCGGCAGCCAGGG - Intergenic
964053221 3:152420722-152420744 TCACAACTCCTCGCCAGCAAGGG + Intronic
964543259 3:157803561-157803583 TCACAACTCCTCGCCAGCAAGGG - Intergenic
965017222 3:163173692-163173714 TCACAACTCCTCGCCAGCAAGGG - Intergenic
966494229 3:180561039-180561061 TCGCAGCTCCTCGCCAGCCATGG + Intergenic
967421089 3:189273704-189273726 TTTCAACTCCAGGCCAACCAGGG - Intronic
1202745081 3_GL000221v1_random:93178-93200 TCACAACTCCCCGCCAGCAAGGG - Intergenic
969164693 4:5297818-5297840 TCACAACTCCTTGCCAGCCAGGG - Intronic
970655277 4:18224347-18224369 TCACAACTCCTCGCCAGCAAGGG - Intergenic
970727305 4:19061248-19061270 TCACAACTCGTCGGCAGCAAGGG + Intergenic
971174153 4:24264619-24264641 TTTGAACTCCATGGCAGCCTGGG - Intergenic
972196284 4:36657128-36657150 TCTCAGCTCCTCGCCAGCAATGG + Intergenic
972219445 4:36936723-36936745 TCACAACTCCTCGCCAGCAAGGG + Intergenic
972755691 4:42043182-42043204 TCACAACTCCTCGCCAGCAAGGG + Intronic
974491501 4:62570978-62571000 TCACAACTCCTCGCCAGCAAGGG - Intergenic
976156685 4:82153052-82153074 TCACAACTCCTCGCCAGCAAGGG + Intergenic
976431808 4:84970890-84970912 TTTCAACTGCACAGCAGCCAGGG + Intergenic
976534216 4:86192810-86192832 TCACAACTCCTCGCCAGCAAGGG - Intronic
976698406 4:87942572-87942594 TCACAACTCCTCGCCAGCAAGGG + Intergenic
977154605 4:93556213-93556235 TCACAACTCCTCGCCAGCAAGGG + Intronic
978090418 4:104707958-104707980 TCACAACTCCTTGCCAGCCAGGG + Intergenic
978139200 4:105298156-105298178 TCACAACTCCTCGCCAGCAAGGG + Intergenic
979043804 4:115835345-115835367 TCACAACTCCTCGCCAGCAAAGG + Intergenic
979326455 4:119385703-119385725 TCGCAGCTCCTCGGCAGCAAGGG - Intergenic
979421519 4:120510215-120510237 TCACAACTCCTCGCCAGCAATGG + Intergenic
979554848 4:122033705-122033727 TCACAACTCCTCGCCAGCAAGGG - Intergenic
980261864 4:130459538-130459560 TCACAACTCCTCGCCAGCAAGGG - Intergenic
980633809 4:135472999-135473021 TCACAACTCCTCGCCAGCAAGGG - Intergenic
981131699 4:141163907-141163929 TCACAACTCCTCGACAGCAAGGG + Intronic
981671675 4:147293573-147293595 TCACAACTCCTCGCCAGCAAGGG + Intergenic
981749994 4:148083642-148083664 TCACAACTCCTCGTCAGCAAGGG + Intronic
981787847 4:148501926-148501948 TCACAACTCCTCGCCAGCAAGGG - Intergenic
981846640 4:149176947-149176969 TCACAACTCCTCGCCAGCAAGGG + Intergenic
982298828 4:153858764-153858786 TCACAACTCCTCGCCAGCAAAGG - Intergenic
983244322 4:165270358-165270380 TCGCAGCTCCTCGGCAGCAAGGG - Intronic
983258365 4:165428070-165428092 TCACAACTCCACTGCAGACTGGG - Intronic
984249723 4:177317644-177317666 TCTCAACAGCACTGCAGCCTGGG - Intronic
984618769 4:181928133-181928155 TCACAACTCCTCGCCAGCAAGGG + Intergenic
985553080 5:543084-543106 TCTCAGCACCACAGCAGCCGGGG + Intergenic
985695932 5:1340088-1340110 CCTTATCTCCACGGAAGCCAGGG + Intronic
986265915 5:6190240-6190262 TCTCAGCTCCACGACAGCAGTGG + Intergenic
986675313 5:10178766-10178788 TCACAACTCCTCGCCAGCAAGGG + Intergenic
988054407 5:26074697-26074719 TCTCCTCCCCATGGCAGCCAGGG - Intergenic
988289933 5:29271443-29271465 TTACAACTCCACGCCAGCAAGGG + Intergenic
989083949 5:37655975-37655997 TCACAACTCCTCGCCAGCAAGGG - Intronic
989194292 5:38700738-38700760 TCACAACTCCTCGCCAGCAAGGG + Intergenic
989320589 5:40130088-40130110 TCACAACTCCTCGCCAGCAAGGG - Intergenic
989825452 5:45848873-45848895 TCACAACTCCATGCCAGCAAGGG + Intergenic
990442684 5:55862444-55862466 ACTGAACTCCACTCCAGCCAGGG - Intronic
990803630 5:59632839-59632861 TCACAACTCCTCGCCAGCAAGGG + Intronic
990981788 5:61607925-61607947 TTTCAACTCCACTGCCCCCACGG + Intergenic
992287406 5:75249228-75249250 TCACAACTCCTCGCCAGCAAGGG + Intergenic
994437938 5:99762833-99762855 TCACAACTCCTCGCCAGCAAGGG - Intergenic
994937356 5:106272215-106272237 TCTCAACTCCTCAGCCCCCAGGG + Intergenic
995136448 5:108685152-108685174 TCACAACTCCTCGCCAGCAAGGG - Intergenic
995811022 5:116107717-116107739 TCACAACTCCTCGCCAGCAAGGG - Intronic
996426489 5:123319349-123319371 TCACAACTCCTCTGCAGCAAGGG - Intergenic
996987371 5:129583948-129583970 TCACAACTCCTCGCCAGCAAGGG - Intronic
997138763 5:131355432-131355454 GCTCCACTCCACTGCAGCCTGGG + Intronic
998531156 5:142886027-142886049 TCACAGCTCCACGGCTGCGATGG - Intronic
998881323 5:146648104-146648126 TCTTAACTGCAAGGCAGCCTAGG - Intronic
999384311 5:151143460-151143482 TCACAATTCCAGGGCAGCTAGGG + Intronic
999502244 5:152159320-152159342 TCACAACTCCTCTGCAGCAAGGG - Intergenic
1002439652 5:179257716-179257738 TTTCAACTCCGAGGCAGCCCTGG + Intronic
1002673660 5:180890803-180890825 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1002685523 5:181006101-181006123 TCCCCACTTCAGGGCAGCCATGG - Exonic
1002944975 6:1751988-1752010 TCACAACTCCTCGGCAGCAAGGG + Intronic
1003078748 6:3004190-3004212 TCTCAACTGCAAGGCAGCCTAGG + Intronic
1003084590 6:3051532-3051554 TCTCAACTGCAAGGCAGCCTAGG - Intergenic
1003315034 6:5004108-5004130 TCCCCACTCCACCGCCGCCAGGG - Intergenic
1003316689 6:5019571-5019593 TCACAACTCCTCGGCAGCAAGGG - Intergenic
1003416765 6:5916883-5916905 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1004028118 6:11838300-11838322 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1004784975 6:18958105-18958127 TTTCAGCCCCAAGGCAGCCATGG - Intergenic
1004944348 6:20595710-20595732 TCACAACTCCTCGCCAGCAAGGG - Intronic
1005778242 6:29161059-29161081 TCTCAACTCCTCTCCAGCAAGGG - Intergenic
1007070114 6:39030227-39030249 CATTAACTCCACGGCACCCAAGG + Exonic
1007858266 6:44880030-44880052 TCACAACTCCTCGCCAGCAAGGG + Intronic
1009998047 6:70919439-70919461 TCACAACTCCTCGCCAGCAAGGG - Intronic
1011020570 6:82808529-82808551 TCACAACTCCTCGCCAGCAATGG - Intergenic
1011086612 6:83547572-83547594 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1012127806 6:95453313-95453335 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1012181175 6:96155096-96155118 TCTCAATTCTACAGCAGTCAAGG + Intronic
1012498034 6:99856238-99856260 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1012799153 6:103802951-103802973 TCGCAGCTCCTCGCCAGCCACGG + Intergenic
1013625529 6:111934001-111934023 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1013920025 6:115393641-115393663 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1013939722 6:115646268-115646290 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1014265168 6:119269061-119269083 TCTACACCCCACGGCAGCAACGG + Intronic
1014278967 6:119419064-119419086 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1014589352 6:123244199-123244221 TCACAACTCCTCGCCAGCAAGGG + Intronic
1015046176 6:128779259-128779281 TCACAACTCCTCGCCAGCAATGG - Intergenic
1016412835 6:143801735-143801757 TCACAACTCCTCGCCAGCAAGGG - Intronic
1016985768 6:149894811-149894833 TCACAACTCCTCGCCAGCAATGG - Intronic
1018950338 6:168374746-168374768 ACTCCACTCCACGGCTGCCCAGG + Intergenic
1020367112 7:7393012-7393034 TCACAACTCCTCGCCAGCAAGGG - Intronic
1021071788 7:16249834-16249856 TCACAACTCCTCGCCAGCAAGGG + Intronic
1021805759 7:24353245-24353267 TCACAACTCCTCGCCAGCAAAGG + Intergenic
1022417936 7:30194130-30194152 TCTCAACTCCACTGGAGCAGAGG - Intergenic
1024594693 7:50922287-50922309 CCTCAACTCCAGGGTGGCCAGGG - Intergenic
1025788010 7:64660991-64661013 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1026024354 7:66732925-66732947 TCTAAACTTCTCGGCAGTCAGGG + Intronic
1027445939 7:78273972-78273994 TCACAACTCCTCGCCAGCAAGGG - Intronic
1027510222 7:79070981-79071003 TCACAACTCCTCGCCAGCAAAGG - Intronic
1027864437 7:83628821-83628843 TCACAACTCCTCGCCAGCAAGGG - Intronic
1028142260 7:87287452-87287474 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1028788248 7:94821361-94821383 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1029459821 7:100688167-100688189 TCGAATCTCCACGGCAGCCGAGG + Intronic
1029854972 7:103505691-103505713 TCACAACTCCTCGCCAGCAAGGG + Intronic
1030534160 7:110744854-110744876 TCACAACTCCTCGCCAGCAAGGG + Intronic
1031050197 7:116937130-116937152 TGTTAACTCCACAGCAGCCAGGG + Intergenic
1031397615 7:121292553-121292575 TCGCAACTCCTCGCCAGCAAGGG - Intronic
1031434173 7:121712499-121712521 TCACAACTCCTCGCCAGCAATGG - Intergenic
1032079184 7:128850132-128850154 TCTCTACTCCTCTGCAGCCAGGG + Intronic
1032603932 7:133329461-133329483 TCACAACTCCTCAGCAGCAAGGG - Intronic
1033583613 7:142758322-142758344 TCTCATCTACATGGCAGTCATGG + Intronic
1033645537 7:143300278-143300300 ACTCACCTCCACGGCAGGCCTGG - Exonic
1033679464 7:143579934-143579956 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1033692372 7:143749509-143749531 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1035374766 7:158400805-158400827 TCTCAGCTGCATGGCAGGCATGG - Intronic
1035710884 8:1712986-1713008 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1036401745 8:8415001-8415023 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1036553896 8:9839750-9839772 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1036708844 8:11065188-11065210 TCTGAGCTCCCCGGCACCCATGG + Intronic
1037285349 8:17293493-17293515 TCACAACTCCTCGCCAGCAAGGG - Intronic
1038032571 8:23655688-23655710 TCTCACCTCCACCACAGCCAAGG + Intergenic
1039203949 8:35128863-35128885 TCTTCTCTCCATGGCAGCCAAGG - Intergenic
1041583836 8:59494161-59494183 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1043748847 8:83909662-83909684 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1043889294 8:85638934-85638956 TCGCAACTCCTCGCCAGCAACGG - Intergenic
1044131222 8:88526297-88526319 TCTCAACTCCTCACCAGCAAGGG + Intergenic
1045974973 8:108122067-108122089 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1046106625 8:109673636-109673658 TCACAACTCCTCGCCAGCAAGGG + Intronic
1048467170 8:134675060-134675082 TCACAACTCCTCGCCAGCGAGGG + Intronic
1050234258 9:3561927-3561949 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1050456835 9:5842388-5842410 TCTCAACTGCACTCCAGCCTGGG + Intergenic
1050700066 9:8329066-8329088 TCACAACTCCTCGCCAGCAAGGG - Intronic
1051998592 9:23248843-23248865 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1052096461 9:24390514-24390536 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1052134203 9:24889867-24889889 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1054985860 9:71261542-71261564 TCACAACTCCTCGCCAGCAAGGG - Intronic
1055061556 9:72073607-72073629 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1055338858 9:75260997-75261019 TCACAACTCCACTCCAGCAAAGG - Intergenic
1055868565 9:80845761-80845783 TCTCAACTGCACTCCAGCCTGGG - Intergenic
1056576719 9:87860112-87860134 CCTTAAGGCCACGGCAGCCATGG - Intergenic
1056901480 9:90604235-90604257 TCACAACTCCATGGCAGAAATGG + Intergenic
1056997645 9:91478679-91478701 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1058093150 9:100828784-100828806 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1058558919 9:106203266-106203288 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1058819162 9:108713120-108713142 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1058819350 9:108714565-108714587 TCACAGCTCCACGCCAGCAACGG + Intergenic
1059457344 9:114407863-114407885 TCTCCTCTCCATGACAGCCACGG - Intronic
1060829314 9:126703834-126703856 TCTCAACTCCACAGGATCCATGG - Intergenic
1060974565 9:127756970-127756992 ACTCAACTCCACTTCAGCCTGGG - Intronic
1203688295 Un_GL000214v1:17097-17119 TCACAACTCCCCGCCAGCAAGGG + Intergenic
1203713706 Un_KI270742v1:123128-123150 TCACAACTCCCCGCCAGCAAGGG - Intergenic
1203647980 Un_KI270751v1:86956-86978 TCACAACTCCCCGCCAGCAAGGG - Intergenic
1185911285 X:3983105-3983127 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1186489633 X:9961385-9961407 TCTCATCAACACGGTAGCCATGG - Intergenic
1187729657 X:22239339-22239361 TCACAACTCCTCGCCAGCAAGGG + Intronic
1188129887 X:26418798-26418820 TCACAACTCCTCGTCAGCAAGGG - Intergenic
1188921799 X:35986644-35986666 TCACAACTCCTCGCCAGCAAGGG - Intronic
1189937892 X:46088227-46088249 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1191012344 X:55773935-55773957 TCACAGCTCCTCGGCAGCAATGG - Intergenic
1191643250 X:63451394-63451416 TCGCAGCTCCACGCCAGCAATGG - Intergenic
1191788639 X:64945115-64945137 TCACAACTCCTCGCCAGCAAGGG - Intronic
1191931237 X:66375677-66375699 TCACAACTCCACGCCAGCAAGGG - Intergenic
1192694865 X:73402453-73402475 TCACAACTCCTCGGCAACAAGGG + Intergenic
1192727913 X:73771600-73771622 TCGCAACTCCTCGCCAGCAATGG + Intergenic
1192755702 X:74045636-74045658 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1192858169 X:75036658-75036680 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1192977173 X:76299162-76299184 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1193068716 X:77283932-77283954 TCCCAACTCCTCGCCAGCAAGGG + Intergenic
1193228311 X:79012435-79012457 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1193350958 X:80463590-80463612 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1193389292 X:80907213-80907235 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1193784251 X:85739963-85739985 TCTCAACTCCTCTCCAGCAAGGG + Intergenic
1194029946 X:88800740-88800762 TCACAACTCCTCACCAGCCAGGG + Intergenic
1195102431 X:101567940-101567962 TCACAACTCCTCGCCAGCAAGGG + Intergenic
1195232881 X:102869218-102869240 TCACAACTCCTCGCCAGCAATGG - Intergenic
1196269673 X:113696948-113696970 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1196631353 X:117943864-117943886 TCACAACTCCTCGCCAGCAAAGG - Intronic
1196946469 X:120832093-120832115 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1196960088 X:120992084-120992106 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1197003962 X:121473918-121473940 TCACAACTCCTCGCCAGCAAGGG - Intergenic
1198217885 X:134573425-134573447 TCTCAACTCCACGGCAGCCACGG + Intronic
1198700390 X:139391334-139391356 TCTCATCTCCACGGCACTCTGGG - Intergenic
1199524782 X:148780786-148780808 TCACAACTCCTCGCCAGCAAGGG - Intronic
1201562941 Y:15336989-15337011 TCTCAAGTCCCCACCAGCCAAGG + Intergenic