ID: 1198219430

View in Genome Browser
Species Human (GRCh38)
Location X:134586168-134586190
Sequence GGTCCAAGAAGACCAACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198219426_1198219430 14 Left 1198219426 X:134586131-134586153 CCTGACTGTAAATCCTGTGCTCT 0: 1
1: 1
2: 1
3: 49
4: 327
Right 1198219430 X:134586168-134586190 GGTCCAAGAAGACCAACAACTGG 0: 1
1: 0
2: 0
3: 11
4: 92
1198219427_1198219430 1 Left 1198219427 X:134586144-134586166 CCTGTGCTCTGTAAATAATTGTT 0: 1
1: 0
2: 0
3: 45
4: 307
Right 1198219430 X:134586168-134586190 GGTCCAAGAAGACCAACAACTGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198219430 Original CRISPR GGTCCAAGAAGACCAACAAC TGG Intronic
901239685 1:7685732-7685754 GATCCAAGAAGACAAACAGAGGG - Intronic
901854503 1:12035990-12036012 GGTCCAAGAAGACAAACTTCAGG - Intergenic
903195007 1:21679421-21679443 TGTCCAAGAAGACCAGTACCTGG + Exonic
905597565 1:39221187-39221209 GGTTCAAGAAGATAAAGAACTGG - Intronic
911425158 1:97700389-97700411 GGTCCAGGAAAAACAAAAACTGG + Intronic
915501433 1:156321460-156321482 GGTCAAAGATGACCACCAACTGG + Intronic
923390470 1:233510069-233510091 GGTCGATGAAAACCAACAAGGGG - Intergenic
1064367019 10:14717429-14717451 GGTCCAAGAACCTCAACACCAGG + Intronic
1066441124 10:35439998-35440020 GGTCCAAGAAGGCCAAGTAGGGG - Intronic
1070753542 10:78977680-78977702 GGTCCAGGAAGACCCACAGAGGG - Intergenic
1076049011 10:127317808-127317830 CTTCCAAGAACACCAAGAACAGG - Intronic
1078982246 11:16549686-16549708 GAACCCAGAAGACCATCAACTGG + Intronic
1082889167 11:58119840-58119862 GGTCCAAAAAGAGAATCAACAGG - Intronic
1083164626 11:60875940-60875962 AGTCAAAGAACACCAACAGCTGG + Intergenic
1083848695 11:65352610-65352632 GGTCCAGGAAGAACAAAAAGGGG - Exonic
1085942140 11:81217560-81217582 GGTCAAAGAAGAACAAAAAAAGG + Intergenic
1092573495 12:9751971-9751993 GGTGCAAGGAGACCATCAAGAGG + Intergenic
1112790613 13:102998985-102999007 GGTCCCAGAAGACTAACTCCTGG + Intergenic
1113166650 13:107450475-107450497 GGTTCAAGAAAACCAACTGCAGG + Intronic
1118812956 14:69288773-69288795 GGTCCAGAAAAACCAACACCTGG + Intronic
1120303695 14:82740125-82740147 TGTCCAAGAAGACAGACAACAGG - Intergenic
1120754942 14:88234067-88234089 GATCCAAGAAGACCAATGTCAGG - Intronic
1121173552 14:91873754-91873776 GGGCCAAGAAGACACACAGCTGG - Intronic
1122003298 14:98682438-98682460 GATCCAGGAAGACCAACAATTGG + Intergenic
1122003477 14:98683666-98683688 GATCCAGGAAGCCCAACAATTGG + Intergenic
1125111551 15:36040092-36040114 GGTCAAATAACACCAACAAAGGG - Intergenic
1125865285 15:43041712-43041734 TCTCAAAGAAGACCATCAACAGG + Intronic
1127703391 15:61524102-61524124 AGTCCAAGAAGAAGAACAAATGG - Intergenic
1129771739 15:78207190-78207212 GGGCCAAGAAGAGGACCAACTGG - Intronic
1134626647 16:15727140-15727162 GGTCCAGGAAGGCACACAACAGG + Intronic
1137239102 16:46639697-46639719 CCTTCAAGAAGACCAAGAACCGG + Intergenic
1139970539 16:70771396-70771418 GGGCCAACAAGACCCACAAGGGG - Intronic
1146142453 17:30379418-30379440 GGGCCAAGTAGATCAACACCTGG - Exonic
1155983138 18:32201829-32201851 GGTCTAAGAAGATCAAGAACAGG - Intronic
1156416706 18:36901575-36901597 GGTCCACAAAGACCAAAAACTGG - Intronic
1157587490 18:48814015-48814037 GGACCCAGAAGACCAAAGACAGG - Intronic
1167178005 19:47879256-47879278 GGTCGAAGGGGACCAACAAATGG + Intronic
926620914 2:15046912-15046934 GCTCCAGGAAGACCTATAACTGG + Intergenic
930796736 2:55400759-55400781 GGTCCAAGAGGACATACAACAGG - Intronic
933811864 2:86037610-86037632 GCTCCCAGAAGACCAAGAACTGG + Intronic
937554575 2:123137804-123137826 TGTCCCAGAAGAGCAAAAACTGG + Intergenic
939752636 2:146066150-146066172 AGTCCAAGGAGACCAAGAATGGG + Intergenic
942503718 2:176619323-176619345 CGTTCAAGAAGATCAACAAATGG + Intergenic
1173618190 20:44416326-44416348 GGCCCAAGAAGCACACCAACTGG - Intronic
1174520703 20:51128312-51128334 GGCCCAAGAAGAGCAAAAAAGGG - Intergenic
1177644767 21:23887240-23887262 GGTGGAAGAAGACAAACAGCTGG + Intergenic
1182880592 22:33729695-33729717 GGACAATGAAGATCAACAACAGG + Intronic
1184946705 22:47808982-47809004 GGTCCACACTGACCAACAACAGG + Intergenic
949642810 3:6058102-6058124 GGTACAAGAAGAACAACCAGGGG - Intergenic
950123853 3:10499652-10499674 GGTCCCAGGAGACCAACATGTGG - Intronic
952585963 3:34892613-34892635 GGTAACAGAAGACCAAGAACAGG - Intergenic
957252278 3:77788300-77788322 GATCCAAGAAGTCCAAGAAAAGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
961663198 3:128481232-128481254 AGTCCAAGAAGAGCAAGAAAGGG - Exonic
969197537 4:5575095-5575117 TGACCAAGAAGACCAAGATCTGG + Intronic
971080307 4:23202544-23202566 TGTCCAAGATGACCTAGAACAGG - Intergenic
971369552 4:26005547-26005569 GGTTAAAGAAGACTAAGAACTGG - Intergenic
971638843 4:29101767-29101789 GGTCCAAGAAGACCTACGTGTGG - Intergenic
972719765 4:41684445-41684467 AGTCCATGAAGACCATCAGCTGG + Exonic
973828639 4:54735907-54735929 GGTCCAAGATGACCACCAGGTGG + Intronic
977531909 4:98210111-98210133 GGTGAAAGAAAACCAACCACGGG - Intergenic
981218635 4:142204526-142204548 GGTACAAGTAAACCCACAACAGG - Intronic
984714231 4:182911719-182911741 GGTCCAAGCATATCCACAACTGG + Intronic
984938199 4:184908229-184908251 AGTCCCAGAAAACAAACAACTGG + Intergenic
985890780 5:2713995-2714017 GGACCCAGAAGACCAGCAGCAGG + Intergenic
991307946 5:65201133-65201155 GGTGCAAGAAGCCCATCAAATGG + Intronic
992558845 5:77930177-77930199 GGTCCAACAAGACCTAGAACAGG + Intergenic
996439065 5:123469095-123469117 GCCCCTAGAAGACCAACATCTGG - Intergenic
996774484 5:127119260-127119282 GGGCAAAAAAGACAAACAACTGG + Intergenic
1000380959 5:160629008-160629030 GGGCCAAGGAAGCCAACAACTGG + Intronic
1007822814 6:44573485-44573507 GGTGCATGAACACCAACAAAGGG + Intergenic
1011428722 6:87260500-87260522 CGTCCAAGAAGATTAACACCAGG + Exonic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1012878093 6:104753478-104753500 GGTGCATGCAGGCCAACAACAGG + Intronic
1015256333 6:131183435-131183457 GGTCCAGGAAGAACAAAAAGGGG + Intronic
1015391608 6:132688794-132688816 GGTACAAAATGTCCAACAACTGG - Intronic
1025004735 7:55344946-55344968 GGTCCGAGAAGACCAAGCGCTGG + Intergenic
1029110817 7:98212305-98212327 GGGCCATGAAGACCAAGAACCGG + Exonic
1029586226 7:101473395-101473417 GGTCCTAGCAGACCAAAAAGCGG - Intronic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1032061564 7:128729490-128729512 GGGCCAAGTGGACCAAGAACAGG + Intronic
1032078851 7:128848806-128848828 AGCCCAAGAAGGCCAACATCCGG + Exonic
1032904911 7:136353444-136353466 TGTCCCTGAAGACCCACAACAGG + Intergenic
1035059017 7:156055448-156055470 GGTCCAAGCAGACCACTCACTGG - Intergenic
1036516695 8:9450887-9450909 GGTCAAAGAAGATCAAGAACTGG + Intergenic
1040064679 8:43135923-43135945 GGTCCAAAAAGCCAAACATCAGG - Intergenic
1042308133 8:67352637-67352659 TCTTCAAAAAGACCAACAACAGG + Intergenic
1047838774 8:128724154-128724176 GGGCCAAGAAGCCAAACAAAAGG + Intergenic
1047950166 8:129925890-129925912 ACTCCTAGAATACCAACAACTGG + Intronic
1049457178 8:142699468-142699490 CCTCCAAGAAGACTAAGAACTGG - Intergenic
1050492035 9:6198212-6198234 GGTCAGAGAAGTCCAACACCAGG - Intergenic
1051024955 9:12597490-12597512 TGTCCAAGGAGACTAATAACTGG + Intergenic
1051844135 9:21432680-21432702 GCTCCAAGAAGAGCAACTCCTGG - Intronic
1053550887 9:39078444-39078466 GGTCCAGAACGACCTACAACAGG + Exonic
1053814997 9:41898521-41898543 GGTCCAGAACGACCTACAACAGG + Exonic
1054615599 9:67288920-67288942 GGTCCAGAACGACCTACAACAGG - Intergenic
1057496398 9:95564669-95564691 GGCCCAGGAAGGCCATCAACGGG - Intergenic
1058152764 9:101480309-101480331 GGTCCTAGAGTACAAACAACAGG - Intronic
1058854135 9:109043498-109043520 GGTCCCAGAAAACCAAGAAAAGG - Intronic
1062557813 9:137123715-137123737 GGTCAAAGAAGAACTACAAGGGG - Intergenic
1190847052 X:54203604-54203626 GGACCCAGAAGATTAACAACTGG + Intronic
1195696346 X:107670463-107670485 GACCCAAGAAGACTATCAACAGG + Intergenic
1197227678 X:123970240-123970262 ATTCCAAGAAAACCAAGAACTGG + Intronic
1198219430 X:134586168-134586190 GGTCCAAGAAGACCAACAACTGG + Intronic