ID: 1198221569

View in Genome Browser
Species Human (GRCh38)
Location X:134607341-134607363
Sequence AGCACACTGGGTAACAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198221569_1198221573 3 Left 1198221569 X:134607341-134607363 CCTACATTGTTACCCAGTGTGCT 0: 1
1: 0
2: 2
3: 15
4: 153
Right 1198221573 X:134607367-134607389 GGCATTATTTTAAAAACACAAGG 0: 1
1: 0
2: 6
3: 52
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198221569 Original CRISPR AGCACACTGGGTAACAATGT AGG (reversed) Intronic
901809648 1:11760323-11760345 GGCACAGTGGGGAACAATGTGGG + Intergenic
903794682 1:25919830-25919852 AGCACAGTGGTTAAGAGTGTGGG + Intergenic
904094068 1:27964194-27964216 ACCAGCCTGGGTAACAAAGTGGG - Intronic
904497943 1:30898015-30898037 AGCTCACTGGCTCACAAGGTGGG - Intronic
908683132 1:66684205-66684227 AGCACACTGGTTAACAACATAGG - Intronic
913476959 1:119246766-119246788 AGCACACTGGGTAGGAAGATCGG + Intergenic
918034112 1:180849697-180849719 AGCATACTGGGTGAGAGTGTGGG + Intronic
920310945 1:205048009-205048031 AGCACACTGGTTAACAGGGCAGG - Intronic
922337585 1:224630382-224630404 AGCTCACTGGGAGACAATTTGGG + Intronic
922816497 1:228453019-228453041 AGCCCACTGGGCAACAAAGGTGG + Intergenic
924143375 1:241048984-241049006 AGAACACTGTGTGACAATGAAGG - Intronic
1063044754 10:2380465-2380487 AGCACACTGTATGATAATGTAGG + Intergenic
1067973918 10:51002550-51002572 ACCACACAGGGTTACATTGTGGG + Intronic
1071205821 10:83275916-83275938 AGTACACTGAGAAAAAATGTAGG + Intergenic
1073894242 10:108136133-108136155 AACACACTGGGGAAAAATGAAGG + Intergenic
1074588679 10:114792122-114792144 ACCAGACTGGGCAACAAGGTGGG + Intergenic
1082887863 11:58107301-58107323 AGAACACTTGGACACAATGTGGG - Intronic
1082953295 11:58841264-58841286 AGCACAGTGGTTAACAACATGGG + Intronic
1083222295 11:61260492-61260514 ACCAGCCTGGGTAACAAAGTAGG - Intronic
1085258908 11:75193211-75193233 AGCACCCTGGGGAAGACTGTGGG - Exonic
1085439793 11:76549302-76549324 AGTACAATAGGAAACAATGTTGG + Intronic
1086953932 11:92916556-92916578 AGCCCTGTGGTTAACAATGTAGG + Intergenic
1086990631 11:93299941-93299963 AGAACAATGGTTAAAAATGTGGG + Intergenic
1087360695 11:97155928-97155950 AGCACACTGCTGAACACTGTGGG + Intergenic
1091653752 12:2329089-2329111 AGCACCCTGAATAGCAATGTTGG + Intronic
1092751254 12:11721413-11721435 AGCAACATGGGTAACCATGTTGG + Intronic
1093997097 12:25654502-25654524 ATCCCACTGGGTACCTATGTGGG - Intergenic
1096174948 12:49508629-49508651 ACCAGACTGGGTAACAAAGTGGG - Intronic
1096921647 12:55093546-55093568 AGCAGCCTGGGTAACATTCTGGG + Intergenic
1098360877 12:69653406-69653428 AGCATAGTGGTTAACAGTGTGGG + Intronic
1099497167 12:83363395-83363417 AGCACACTCTGTAGAAATGTGGG + Intergenic
1102463299 12:113113471-113113493 AGCACACTTGATAACGATGGAGG - Intronic
1103514303 12:121497097-121497119 AGCACAGTGGTCAAGAATGTTGG + Intronic
1107518218 13:41152599-41152621 AGCAAGCTGGGAAACAATGGTGG + Intergenic
1109334574 13:60976890-60976912 AGCACAGTGGTTATCAATCTAGG + Intergenic
1113880432 13:113622447-113622469 AGCACCCTGGGAAACAAGTTGGG - Intronic
1117750470 14:58917387-58917409 ATCGCACTGGGTAACAAAGTGGG - Intergenic
1119722855 14:76902872-76902894 AGCACAGTGGTTCACAATCTGGG - Intergenic
1119800302 14:77438474-77438496 AGCACACTGGGAGACCAAGTTGG - Intronic
1120988614 14:90355424-90355446 ACAAAACTGGGTAACAGTGTAGG - Intergenic
1122154887 14:99744284-99744306 ATCACACTGGGTCACCGTGTAGG - Intronic
1124815281 15:32984555-32984577 AACACTCTGAGTAACAATGAAGG + Intronic
1127848884 15:62896212-62896234 AGCTCACTGGAAAAGAATGTGGG + Intergenic
1130805961 15:87322563-87322585 AACACACAGAGTAACAATTTGGG - Intergenic
1133522499 16:6572916-6572938 AGCACTCTTGGGAACAAAGTAGG - Intronic
1134300188 16:12983971-12983993 AGTAGAATGGGTACCAATGTAGG - Intronic
1134425096 16:14134615-14134637 AGCACAATGCCTAATAATGTAGG + Intronic
1139398930 16:66664460-66664482 AGCAAAATCTGTAACAATGTTGG + Intronic
1140174290 16:72640371-72640393 ACCAGCCTGGGTAACAAAGTGGG + Intergenic
1140816876 16:78629310-78629332 AGCACACTTGATAGCAATGTAGG + Intronic
1141503967 16:84462733-84462755 AGCACACTGGGGAAAAGGGTGGG - Intronic
1141513307 16:84526433-84526455 ACCAGCCTGGGTAACAAAGTGGG - Intronic
1141788389 16:86216834-86216856 AGCACCTTGGGTAAGAATGAGGG + Intergenic
1146866798 17:36343567-36343589 ACCACACCTGGTAAGAATGTTGG - Intronic
1147069666 17:37944176-37944198 ACCACACCTGGTAAGAATGTTGG - Intergenic
1147081196 17:38023714-38023736 ACCACACCTGGTAAGAATGTTGG - Intronic
1147097138 17:38147671-38147693 ACCACACCTGGTAAGAATGTTGG - Intergenic
1147222393 17:38944327-38944349 AGCAACCTGGGTACCAAAGTGGG + Intronic
1149889743 17:60376808-60376830 ACCACACCTGGTAAGAATGTTGG + Intronic
1155888279 18:31235366-31235388 AGCACAGTGGGAAACACTGGAGG - Intergenic
1155915714 18:31555102-31555124 AGTACACAGGGGAACAATGCGGG - Intergenic
1160564550 18:79778958-79778980 AGCACACAGAGTAACAATAAGGG + Intergenic
1161472401 19:4465218-4465240 ACCAGTCTGGGTAACAAAGTGGG + Intergenic
1165302972 19:34983797-34983819 ACCACACTGGGGACCAAAGTGGG - Intergenic
926828047 2:16928823-16928845 AGCTCACTATGTAACAATGAAGG + Intergenic
929090183 2:38208562-38208584 AGCACAGTGGTTAAGAGTGTGGG + Intergenic
929549540 2:42880608-42880630 AGGACAATAGGAAACAATGTGGG - Intergenic
930658392 2:54029750-54029772 AGCATGCTGGGGAACATTGTAGG + Intronic
933790225 2:85878115-85878137 AGCTCACTGTGGCACAATGTAGG + Intronic
933874378 2:86603914-86603936 GGCAAACAGGGCAACAATGTCGG + Exonic
935845695 2:107163474-107163496 AGCACACTGGGACACCATGCAGG - Intergenic
936749858 2:115629004-115629026 AGAACACTGGGTCACAGGGTGGG - Intronic
939102520 2:137911678-137911700 AGCACCCTAGGCAAAAATGTTGG - Intergenic
939707298 2:145470928-145470950 AACACAGTGGGGAAAAATGTTGG - Intergenic
940392554 2:153149573-153149595 AGAACTCTGGGTCACAATTTAGG + Intergenic
941270975 2:163428604-163428626 AGCAGACAGGGTAACTATGAAGG + Intergenic
946906111 2:224418014-224418036 ACCAGCCTGGGTAACACTGTGGG - Intergenic
947401935 2:229740043-229740065 ACCAGCCTGGGTAACAAAGTGGG + Intergenic
1170136832 20:13083840-13083862 ACCACACTGGTCAACACTGTTGG + Intronic
1173901186 20:46590113-46590135 AGGACACTGGGTGACCATTTGGG + Intronic
1175540997 20:59747583-59747605 AGCACTCTTGGTAAGAAAGTTGG + Intronic
1175630540 20:60531931-60531953 AGCACACTTGGACACAAGGTGGG + Intergenic
1177973388 21:27817945-27817967 AACAAACTGGGAAACATTGTTGG - Intergenic
1183926401 22:41209405-41209427 AGAATACTGTATAACAATGTGGG - Intronic
950167426 3:10812205-10812227 AGCACAGTGGGTAAGAATGTTGG - Intergenic
951948112 3:28165583-28165605 AGCACACTTGACAATAATGTGGG - Intergenic
955250001 3:57271685-57271707 AGCACCCTGGGTCATAGTGTAGG + Exonic
956078326 3:65530345-65530367 AGCACAGTGGCTAAAAATATAGG + Intronic
956365409 3:68496673-68496695 AGCACAGTGGTTAAGAATATGGG + Intronic
957802350 3:85101573-85101595 AACATACTGGATAATAATGTAGG + Intronic
958033200 3:88139098-88139120 AGCACACTGGAAAATAATGCAGG + Exonic
959460390 3:106618360-106618382 AGCTCACTTAGTAACTATGTTGG - Intergenic
960038657 3:113127270-113127292 AGCACACTGGCTCAGAATGCAGG + Intergenic
963028001 3:140939214-140939236 TTCACACTGGGTAACAGTGTGGG + Intergenic
966847400 3:184141319-184141341 AGCACACTGGGAAGCCATGGTGG + Intronic
967356658 3:188579307-188579329 AGAACACTGGGAAAAAAGGTCGG + Intronic
968118160 3:196105471-196105493 AGAACACTGGGTAAGAACGAAGG + Intergenic
969528222 4:7714993-7715015 GGCACACAGGGTAACAAGGGAGG - Intronic
971078506 4:23178943-23178965 AGCACACAGGGACACAAGGTCGG + Intergenic
972531573 4:39966234-39966256 ATCACACTGTGTAGCAATGAGGG + Intronic
972733082 4:41814154-41814176 TCCACCCTGGGTAACAGTGTGGG + Intergenic
972852623 4:43070073-43070095 AGCAGACTGGAAAAAAATGTAGG - Intergenic
973344272 4:49037321-49037343 AGCACTTTGGGAAACAAGGTGGG + Intronic
974081636 4:57219861-57219883 AGCAGAATGGTTAACAGTGTGGG + Intergenic
978281103 4:107015636-107015658 AAAACATTGGGTAACAATGTGGG - Intronic
980224662 4:129965796-129965818 AGGACACTGTGTAACATTTTTGG - Intergenic
981325089 4:143437046-143437068 AGCACAATGTGGCACAATGTGGG + Intronic
981698395 4:147581923-147581945 ATCACACTGACCAACAATGTGGG - Intergenic
986763341 5:10899790-10899812 AGCACCCTGGGGATTAATGTAGG + Intergenic
987134009 5:14884202-14884224 AGCAGACTCAGTAACAATGTAGG + Intergenic
987225077 5:15831653-15831675 CGCACTCTGGGAAACATTGTTGG + Intronic
988820837 5:34883249-34883271 AGCTTGCTGGATAACAATGTAGG - Intronic
992936407 5:81711756-81711778 AGCATAATGGTTAACAGTGTGGG + Intronic
998950716 5:147390789-147390811 AGAAGACTGGAGAACAATGTTGG + Intronic
1001335024 5:170789775-170789797 AGTACACTGGGGAGCATTGTAGG - Intronic
1003027295 6:2566735-2566757 AGGACACTAGGTAAAAATGAAGG - Intergenic
1007231338 6:40349407-40349429 AGGGCACTGGGTAGCAATCTGGG - Intergenic
1007303125 6:40883524-40883546 AACACACTGAGTATGAATGTGGG - Intergenic
1007747092 6:44049900-44049922 AGCACACTTGGTGACCAAGTTGG + Intergenic
1008157954 6:48040180-48040202 GCCACACTGGGTAATAAGGTTGG + Intronic
1011462265 6:87617042-87617064 AGCACTCTGGGAACCAAGGTGGG - Intronic
1013630378 6:111980540-111980562 AGCAAACTGCGTGACAATGCTGG + Intergenic
1015220425 6:130798361-130798383 AGAAAACTGGGTATCCATGTGGG - Intergenic
1015547276 6:134374423-134374445 AGCTCACTGAGCAGCAATGTTGG - Intergenic
1015756126 6:136608523-136608545 AGTGCCCTGGATAACAATGTCGG + Intronic
1017585122 6:155912000-155912022 AGCTCACTGCTTAAAAATGTGGG + Intergenic
1017730438 6:157311058-157311080 AGCACACTGGGGCACTATGATGG - Intronic
1017730788 6:157313601-157313623 AGCACACTGGGGCACTATGATGG - Intronic
1018177632 6:161191294-161191316 AGCACAGTGGGTTAGAGTGTGGG - Intronic
1021493725 7:21248909-21248931 AGCACAGTGGTTAAGAGTGTTGG - Intergenic
1026036193 7:66832213-66832235 AGAACACTGGTTCACAATGCAGG + Intergenic
1026089048 7:67284900-67284922 AGCACACTGGCTCACCATCTTGG + Intergenic
1026740121 7:72973966-72973988 TGCACACTGGGTAACAAGATGGG + Intergenic
1027103612 7:75391104-75391126 TGCACACTGGGTAACAAGATGGG - Intergenic
1029593316 7:101521626-101521648 AGCACATAGGGTGACAAGGTTGG + Intronic
1030710720 7:112745563-112745585 AGCACACTAGTTATCAAGGTGGG - Intergenic
1031192579 7:118573101-118573123 AGCAGACTGGTTAACAAAGGTGG - Intergenic
1032617234 7:133486958-133486980 AGTACACTTGATAACAATCTTGG - Intronic
1035429884 7:158811359-158811381 AGCTCACTGGGTACCTTTGTTGG - Intronic
1036165631 8:6430013-6430035 AGCAAACAGGGTGACATTGTGGG - Intronic
1037107765 8:15130345-15130367 AGCACACTGGGTAGATATGTGGG - Intronic
1038912345 8:31980136-31980158 AGCACAGTGGTTAAAAATGTAGG - Intronic
1040976434 8:53198746-53198768 AGCACACTGGTGGACAATCTTGG + Intergenic
1044290256 8:90459973-90459995 AGCACAGTGGGTAAAGTTGTGGG + Intergenic
1044679811 8:94765948-94765970 AGCATACTGGGTAAGAAAGTAGG + Intronic
1044936997 8:97302979-97303001 AGCACAGTGGGTGACACAGTGGG + Intergenic
1045750090 8:105473146-105473168 AGCACACTGGGAAGCAAGGCAGG - Intronic
1046466541 8:114611592-114611614 TGCATCCTGGGTAACAATTTGGG - Intergenic
1048012570 8:130469914-130469936 AGGACACTGGTGACCAATGTGGG + Intergenic
1052034319 9:23662670-23662692 ATAACCCTGGGTAACAATGGTGG + Intergenic
1053012434 9:34641939-34641961 AGCACACTGGGAAACCAAGGCGG - Intronic
1054933994 9:70667391-70667413 AGCACACTGGGAACCAAGTTGGG + Intronic
1058812260 9:108652454-108652476 AGAACAGTGGTTAACAGTGTGGG - Intergenic
1060002788 9:119973657-119973679 AGCACACTGAGTGATAATGTTGG - Intergenic
1060425035 9:123497342-123497364 AGCAGCCTGGGTGACAAAGTGGG - Intronic
1061532669 9:131227310-131227332 AGCCCACTGGGCAGCAGTGTTGG + Intronic
1061924361 9:133798660-133798682 ACCACACCAGGTGACAATGTTGG + Intronic
1188639895 X:32488052-32488074 AGCACACTTGGCTATAATGTTGG - Intronic
1189142761 X:38623979-38624001 AGCACAGTGGATGACAATGTGGG - Intronic
1190307533 X:49093786-49093808 AGCACTTTGGGGAACAAGGTGGG - Intronic
1190477001 X:50838357-50838379 AGCATAGTGGGTAAACATGTGGG + Intergenic
1193641374 X:84013438-84013460 AGAACACTTGGTCACAGTGTGGG + Intergenic
1193859796 X:86651415-86651437 AGCACAATGGCTAACATTATAGG - Intronic
1194281310 X:91957697-91957719 AGGAGACTGGATAACCATGTTGG + Intronic
1194824378 X:98543266-98543288 AACACCCTGGGAAACAATATTGG - Intergenic
1197596404 X:128469344-128469366 AGCACAGTGGCTAACAATGTGGG + Intergenic
1198221569 X:134607341-134607363 AGCACACTGGGTAACAATGTAGG - Intronic
1198603700 X:138313380-138313402 AGCATCCTGGGTATCAATTTAGG - Intergenic
1199449459 X:147963269-147963291 AACACCCTGGATGACAATGTAGG + Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic
1200932942 Y:8713765-8713787 ACAACACTGGATAAAAATGTTGG - Intergenic