ID: 1198223204

View in Genome Browser
Species Human (GRCh38)
Location X:134621923-134621945
Sequence GTGGGCTGGCTTCCATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 379}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198223204_1198223206 -7 Left 1198223204 X:134621923-134621945 CCTGGAGATGGAAGCCAGCCCAC 0: 1
1: 0
2: 2
3: 32
4: 379
Right 1198223206 X:134621939-134621961 AGCCCACAATATTTTCTGATCGG 0: 1
1: 0
2: 0
3: 26
4: 214
1198223204_1198223211 30 Left 1198223204 X:134621923-134621945 CCTGGAGATGGAAGCCAGCCCAC 0: 1
1: 0
2: 2
3: 32
4: 379
Right 1198223211 X:134621976-134621998 CCTCTCTTTTGAGTTCAAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 121
1198223204_1198223209 27 Left 1198223204 X:134621923-134621945 CCTGGAGATGGAAGCCAGCCCAC 0: 1
1: 0
2: 2
3: 32
4: 379
Right 1198223209 X:134621973-134621995 GATCCTCTCTTTTGAGTTCAAGG 0: 1
1: 0
2: 2
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198223204 Original CRISPR GTGGGCTGGCTTCCATCTCC AGG (reversed) Intronic
900998873 1:6137540-6137562 CTAGGCTGGCTTCAAACTCCCGG + Intronic
901158786 1:7159177-7159199 ATGGGCTGCCTTTCATCACCAGG + Intronic
901206205 1:7497277-7497299 GGTGGCTGGCTTCTAGCTCCAGG - Intronic
901554544 1:10021230-10021252 TTGGGCTGGTCTCCAACTCCTGG + Intergenic
901661619 1:10801652-10801674 ATGTGCTGGGTTCCTTCTCCTGG + Intergenic
901856583 1:12048172-12048194 GCAGGCTGGTCTCCATCTCCTGG - Intergenic
902088346 1:13880721-13880743 GTAGGCTGGCCTCGAACTCCTGG + Intergenic
902340757 1:15782200-15782222 GCAGGCTGGCTTCGAACTCCTGG - Intronic
902555145 1:17242541-17242563 GTGGTCTGGCCTCCATCTGCCGG + Intronic
902988636 1:20171048-20171070 GTGGGCTGGCTGCACTCGCCAGG - Intronic
903173453 1:21567466-21567488 GTGGGCTGGCTCCCAGCTGTGGG + Intronic
903530410 1:24026036-24026058 CTAGGCTCACTTCCATCTCCCGG + Intergenic
903764939 1:25728064-25728086 GGGGCCTGGCTTCCATCTCCTGG - Intronic
904254519 1:29246287-29246309 GTAGGCTGGCGTCCTTTTCCAGG + Intronic
904353590 1:29924496-29924518 CTGGCCTGGCTTCCATCCCCTGG + Intergenic
904412987 1:30336148-30336170 GTGAGTTGGCTGCCCTCTCCAGG + Intergenic
904836777 1:33342749-33342771 GTGGACTGGCCTCCATCACCAGG - Intronic
905624015 1:39475029-39475051 GTGGTCTGGCATCCATCACCTGG - Intronic
906406005 1:45542683-45542705 GCAGCCTGGCTTCCTTCTCCAGG - Intergenic
907025284 1:51111871-51111893 CTGGGCTGGTATCCAACTCCTGG + Intronic
907025995 1:51119581-51119603 CTGGGCTGGTTTCCAGTTCCTGG - Intronic
907153488 1:52310492-52310514 CTAGGCTGGCCTCCACCTCCTGG - Intronic
908277470 1:62490279-62490301 GCGGGCTGGTTTCAAACTCCTGG + Intronic
912857712 1:113186113-113186135 CTGGGCTGGTCTCCAACTCCTGG - Intergenic
915567698 1:156725300-156725322 GTTGGCTGGCCTCAAACTCCTGG + Intronic
915569966 1:156739580-156739602 GTGGTCTGACTTCCTTGTCCAGG - Intronic
916447103 1:164882647-164882669 TTAGGCTGGCCTCCAACTCCTGG + Intronic
917380947 1:174407406-174407428 AGTGGCTGGCTTCCATCTCAAGG + Intronic
918003452 1:180520103-180520125 CTGGGCTAGCTCCCATCTCCAGG - Intergenic
918197784 1:182238564-182238586 TTGGTCTGGCTTCCATGTCATGG + Intergenic
918197922 1:182239973-182239995 TTGGTCTGGCTTCCATGTCGTGG - Intergenic
919982139 1:202648633-202648655 GTCTGCTGGCATCCATCTTCTGG + Intronic
920372767 1:205490006-205490028 GTGGGCTGAGCTCCAGCTCCTGG + Intergenic
920534627 1:206729539-206729561 GTGGCCTGGCAACCATCTCTGGG - Intronic
920546017 1:206819148-206819170 TTGGGCTGGCCTCAAACTCCTGG + Intronic
921986083 1:221314164-221314186 GTGGGCCAGCTTCCACCACCAGG + Intergenic
922472964 1:225887994-225888016 GTGTGCTGGCCTCCAACGCCAGG + Exonic
923084246 1:230690338-230690360 GTGGGCTGGCTTCCTCTGCCTGG + Intronic
923365114 1:233252184-233252206 GTGTGCTGCCTCCCATCTCGGGG - Intronic
923448182 1:234092067-234092089 GTTGGCTGCCTTCCAGCTCCTGG - Intronic
924299796 1:242625830-242625852 GGGGGCTGCCCTCCAACTCCAGG - Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063244854 10:4207078-4207100 GTGAGCTGGCTTCATTCACCGGG + Intergenic
1063743440 10:8852685-8852707 GAGGGCTGGCTTTCAACTGCAGG - Intergenic
1064536580 10:16363610-16363632 GTGGGCTGGTCTCAAACTCCTGG - Intergenic
1064714067 10:18157270-18157292 GTAGCCTGGCTTCCAAGTCCAGG - Intronic
1065019243 10:21489356-21489378 GTAGGCTGGTTTCAAACTCCTGG + Intergenic
1065232558 10:23613260-23613282 GTGGGCTGGGTTCAAACTCCGGG - Intergenic
1065785110 10:29205506-29205528 CCGGGCTGGCCTCCAACTCCTGG + Intergenic
1065963603 10:30753571-30753593 GTGGCCGGCCTTCCATCTTCTGG + Intergenic
1065967308 10:30780636-30780658 CTGGGCTGGTCTCCAGCTCCTGG - Intergenic
1066108798 10:32178480-32178502 CTGGGCTGGTCTCAATCTCCTGG - Intergenic
1066115242 10:32233570-32233592 GGGGGCTGCCCTCCACCTCCTGG + Intergenic
1066141360 10:32506640-32506662 CTGGGCTGGTCTCCAGCTCCTGG - Intronic
1066243932 10:33563623-33563645 CTGGGCTGACTTACATCGCCTGG - Intergenic
1067086404 10:43242740-43242762 CCGGGCTGGTTTCCAGCTCCTGG + Intronic
1067196398 10:44123254-44123276 GTGGGCCTGCCTCCCTCTCCAGG - Intergenic
1068536143 10:58243577-58243599 CTGGGCTGGTCTCCAGCTCCTGG + Intronic
1069659748 10:70115953-70115975 CTGGACTGGCTTCCTTTTCCTGG + Intronic
1070050206 10:72881477-72881499 GTTGGCTGGCCTCAAACTCCTGG - Intronic
1070070008 10:73079244-73079266 CTGGGCTGGTTTCGAACTCCTGG - Intronic
1071526529 10:86362847-86362869 GTGGGCTGGCTAAGAGCTCCTGG - Intronic
1071567421 10:86678847-86678869 CTGGGCTGGCCTCAAACTCCTGG + Intronic
1073029233 10:100511558-100511580 CCAGGCTGGCTTCCATCTCCTGG - Intronic
1074159017 10:110821862-110821884 GGGGGCTGGCTTTCTCCTCCAGG - Exonic
1075090471 10:119441466-119441488 GTGAGCTGGGATTCATCTCCAGG + Intronic
1076522568 10:131090216-131090238 GCAGGATGGCCTCCATCTCCAGG - Intergenic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1077105233 11:839287-839309 GAGCCCTGGCTCCCATCTCCAGG - Intronic
1078340495 11:10495181-10495203 GTGGTCTGGCTGCCTGCTCCAGG + Intronic
1078548615 11:12264525-12264547 GTGGGATGCCTGCCATTTCCTGG + Intergenic
1078922300 11:15842002-15842024 CTGGGCAGGCTTCCAGATCCCGG + Intergenic
1079015113 11:16862207-16862229 TTGGGCTGGTTTCTAGCTCCTGG - Intronic
1079051112 11:17160612-17160634 CTAGGCTGGTCTCCATCTCCTGG - Intronic
1080524762 11:33104034-33104056 CTGGGCTGGCCTCAAACTCCTGG + Intronic
1083438412 11:62659366-62659388 CTAGGCTGGCCTCCAACTCCTGG - Intronic
1084112357 11:67022503-67022525 GTGGGCGATCTTCCATCTTCCGG - Intronic
1084319681 11:68366333-68366355 GTGGGCTGGCTTCCACACTCAGG + Intronic
1084636750 11:70398270-70398292 CTCGGCTGGCTTCCTTCCCCCGG + Intergenic
1084824905 11:71722609-71722631 CTGGGCTGGTTTCGAACTCCTGG + Intergenic
1085357559 11:75853120-75853142 TTGGGCTGGTCTCCAACTCCTGG + Intronic
1087148067 11:94831864-94831886 CTAGGCTGCCTTCCATTTCCTGG - Intronic
1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG + Intronic
1087936079 11:104036228-104036250 CCGGGCTGGCCTCCAACTCCTGG - Intronic
1090289159 11:125526831-125526853 GTAGGCTGGTCTCCATTTCCTGG + Intergenic
1090406209 11:126477094-126477116 TTAGGCTGGCTTCCAGCTCTGGG - Intronic
1090985226 11:131760680-131760702 GGGGCCGGGGTTCCATCTCCGGG + Intronic
1091739305 12:2948818-2948840 CTAGGCTGGTTTCCAACTCCTGG + Intergenic
1091917617 12:4280974-4280996 TTGGGCTGGCTGCCAGCTCCGGG + Intronic
1091955351 12:4636953-4636975 CTGGGCTGGTCTCCAACTCCTGG + Intronic
1094504715 12:31051901-31051923 GTAGGCTGGCTTTCAACTTCGGG + Intergenic
1094518015 12:31153417-31153439 GCAGGCTGGTTTCGATCTCCTGG + Intergenic
1096605215 12:52760247-52760269 GTGGGCTGCCTGCCATCCCTGGG + Intergenic
1096919858 12:55072282-55072304 GTGGGGTGGCTGCCCTCTGCTGG + Intergenic
1098432154 12:70431641-70431663 GTGAGCTGGGTTGCATCTCCAGG - Exonic
1099534043 12:83823873-83823895 GTGGGGTGGCTGCCCTCTGCTGG + Intergenic
1100439449 12:94602664-94602686 CCAGGCTGGCTTCCAACTCCGGG + Intronic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1100820402 12:98424002-98424024 GCAGGCTGGTCTCCATCTCCTGG - Intergenic
1101816005 12:108146679-108146701 GTGGGCTGGCGTCCAGGTTCAGG + Intronic
1102885050 12:116515550-116515572 GTGGGCTGGTCTCGAACTCCTGG - Intergenic
1103458217 12:121083923-121083945 ATGGGCTGTCTTCTATGTCCTGG - Intergenic
1103579097 12:121901032-121901054 GTAGGTTGGTCTCCATCTCCTGG + Intronic
1103876129 12:124128693-124128715 TTGGCTTGGCTTCCATCTCTGGG + Intronic
1104559499 12:129831157-129831179 GTGGGCTGGGTCCCAGTTCCTGG - Intronic
1104685958 12:130784296-130784318 CTAGGCTGGCCTCCAACTCCTGG - Intergenic
1105017714 12:132796220-132796242 GTGGGCTTCATTCCTTCTCCAGG - Exonic
1105496534 13:20935610-20935632 CTGGGCTGGCCTCCAACTCCTGG - Intergenic
1105507987 13:21026744-21026766 CTAGGCTGGTCTCCATCTCCTGG - Intronic
1105902061 13:24764076-24764098 GGGGGCGGGCTTTAATCTCCCGG + Intergenic
1106017729 13:25885024-25885046 CTGAGCTGGCCTCCATGTCCTGG + Intronic
1107229050 13:38086316-38086338 GGGGGCTGGCTGCCATTTCTAGG + Intergenic
1107560648 13:41554200-41554222 CTGGGCTGGTCTCAATCTCCTGG + Intergenic
1112499456 13:99931344-99931366 GTGGGCTGATTTCTATTTCCTGG + Intergenic
1113870665 13:113557960-113557982 GAGGGCTGTCTTCCATCCCTGGG - Intergenic
1115568127 14:34642461-34642483 CTAGGCTGGCCTCTATCTCCCGG - Intergenic
1116012709 14:39369501-39369523 GTAGACTGGCTTCCAGCCCCTGG + Intronic
1118345789 14:64939768-64939790 GTGGGCTGGTATCCACCCCCAGG + Exonic
1118356724 14:65020320-65020342 CTGGGCTGGTCTCAATCTCCTGG + Intronic
1118827712 14:69398899-69398921 GTGGGCTGGTTTCCTGCTCTGGG + Exonic
1119722019 14:76898128-76898150 GGGGGCTGGCCCCCACCTCCCGG + Intergenic
1119858429 14:77918612-77918634 GGGGGCTGGCTTCCCTCTTCTGG + Intronic
1120967760 14:90182610-90182632 CTGGGCTGGCCTCGAACTCCTGG - Intronic
1120972956 14:90224293-90224315 GTTAGGTGGGTTCCATCTCCCGG - Intergenic
1121750336 14:96349077-96349099 GTGGGCTGCCTTGAATCTGCAGG - Intronic
1122060889 14:99136087-99136109 GTGGGCTGCCAGCCACCTCCTGG - Intergenic
1122077934 14:99247544-99247566 GTTGGCTGGCTACACTCTCCAGG + Intronic
1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG + Intergenic
1122569263 14:102683696-102683718 GCGCACTGGCTGCCATCTCCAGG - Intronic
1122659018 14:103282020-103282042 GTGAGCTGGCTGCCAGCTGCTGG + Intergenic
1122726673 14:103759513-103759535 CTGTGCTGGCCTCAATCTCCTGG + Intronic
1122889369 14:104725307-104725329 ATGGGCTGACTTACAGCTCCAGG + Intronic
1123028709 14:105440557-105440579 GGGGGCTGGCTTCCAGCCCTTGG + Intronic
1123434486 15:20245098-20245120 GGGTGCTGGCTTCCATCTGCGGG - Intergenic
1124157585 15:27240312-27240334 GTGGACTAGCTCCCACCTCCAGG - Intronic
1126126683 15:45300305-45300327 CCAGGCTGGCTTCCAACTCCTGG + Intergenic
1127631309 15:60829700-60829722 GTGAGATTTCTTCCATCTCCTGG - Intronic
1128018094 15:64365339-64365361 CTGGGCTGGTCTCCAACTCCTGG + Exonic
1128694468 15:69750155-69750177 CTGGGCTGGCTTCCACTTTCGGG + Intergenic
1129172482 15:73816731-73816753 GTGGCCTGGCTTCTACCTTCAGG - Intergenic
1129717655 15:77861548-77861570 GATGCCTTGCTTCCATCTCCTGG - Intergenic
1129933977 15:79433787-79433809 GTGAGCTAGCTTCCACCTGCAGG - Intronic
1130461106 15:84158698-84158720 GATGCCTTGCTTCCATCTCCTGG + Intergenic
1130655924 15:85792146-85792168 CTGGGCTGACTTCCATCAGCTGG + Intronic
1130932242 15:88437853-88437875 GTGGGCTGGGTACCAGCTACTGG + Intergenic
1132145836 15:99429286-99429308 GCGGGCTGGTCTCAATCTCCTGG + Intergenic
1133417803 16:5619852-5619874 GGGGGCTCACTTCCTTCTCCTGG + Intergenic
1133690531 16:8210226-8210248 AAGCGATGGCTTCCATCTCCTGG + Intergenic
1133968321 16:10547821-10547843 CTGGGCTGGTCTCAATCTCCTGG - Intronic
1134483598 16:14639202-14639224 GTAGGCTGGTCTCCAACTCCTGG + Intronic
1134622833 16:15702613-15702635 CTAGGCTGGCCTCCAACTCCTGG + Intronic
1134692282 16:16198637-16198659 GCGGGCTGGTTTCGAACTCCTGG - Intronic
1135541987 16:23337261-23337283 CTGGGCTGGTTTCAAACTCCTGG + Intronic
1135558196 16:23454488-23454510 AGTGGCTGGCTGCCATCTCCAGG + Intergenic
1135709538 16:24703501-24703523 CTAGGCTGGCCTCAATCTCCTGG - Intergenic
1136352802 16:29722167-29722189 CTAGGCTGGCTTCAAACTCCTGG + Intergenic
1136355542 16:29743035-29743057 CTGGGCAGGTTTCCAACTCCTGG - Exonic
1136850132 16:33606005-33606027 GGGTGCTGGCTTCCGTCTGCAGG + Intergenic
1137780601 16:51094955-51094977 CTGGGCTGGTCTCAATCTCCTGG - Intergenic
1140446743 16:75035241-75035263 CTGGGCTGGTCTCCAACTCCTGG + Intronic
1140497187 16:75399586-75399608 CTGGGCTGGATTCAAACTCCTGG + Intronic
1140537715 16:75725804-75725826 CTGGGCTGGTTTCAAACTCCTGG + Intronic
1141120125 16:81347393-81347415 ATGGACTGGCTTCCTTCTGCTGG + Intronic
1141133657 16:81451818-81451840 GTGGCCTGGCTTCCATCCTGGGG - Intronic
1203111745 16_KI270728v1_random:1454458-1454480 GGGTGCTGGCTTCCGTCTGCAGG + Intergenic
1142849887 17:2699535-2699557 GTAGGCTGGTTTCCAACTCCTGG + Intronic
1146097347 17:29944288-29944310 CTGGGCTGGTCTCGATCTCCTGG + Intronic
1147633869 17:41950583-41950605 GTTGGCTGGTTTCAAACTCCTGG + Intronic
1148100155 17:45085036-45085058 CTGGGCTGGCCTCGAACTCCTGG - Intronic
1148103857 17:45108912-45108934 GTGGGGGGGCATCCATTTCCAGG + Exonic
1149829368 17:59857862-59857884 CTGGGCTGGTTTCAAACTCCTGG - Intergenic
1150245819 17:63674353-63674375 CTGGGCTGGTTTCGAACTCCTGG - Intronic
1152195615 17:78916573-78916595 AGGGCCTGCCTTCCATCTCCTGG + Intronic
1153216731 18:2827724-2827746 CCAGGCTGGCTTCCAACTCCTGG - Intergenic
1153518300 18:5925942-5925964 CCAGGCTGGCTTCCAACTCCTGG - Intergenic
1154198944 18:12286180-12286202 CTAGGCTGGCCTCCATCTCCTGG - Intergenic
1155229548 18:23759127-23759149 CTAGGCTGGTTTCCAACTCCTGG - Intronic
1156614797 18:38770724-38770746 GTTGGCTGGCTTCTATAGCCTGG + Intergenic
1156703210 18:39849283-39849305 GTGGCCTGGCCTCAAACTCCTGG + Intergenic
1157643556 18:49243161-49243183 GTGAGCGGGCTGCCTTCTCCTGG + Intronic
1157677878 18:49580587-49580609 CTGGGCTGGCCTCAAACTCCTGG - Intronic
1157982176 18:52394484-52394506 CTGGCCTGGTTTCCAACTCCTGG + Intronic
1158989264 18:62852087-62852109 CTGGGCTGGCCTCAATCTCCTGG + Intronic
1161032477 19:2064555-2064577 CGGGGCTGGCATCCACCTCCTGG + Intergenic
1161049604 19:2156130-2156152 GTGGGCTGGCTGCAACCTCCAGG + Intronic
1161169618 19:2806290-2806312 GTGGGCTGAGTTCCAGGTCCCGG + Intronic
1161201716 19:3018971-3018993 TTGGGCTGGCCTCTAACTCCCGG + Intronic
1161628154 19:5338817-5338839 GCGGGATGGCTTCCTTCTCCCGG + Intronic
1162437013 19:10667078-10667100 GTGGGCTGGTCTCAAACTCCTGG - Intronic
1162753943 19:12846006-12846028 CCAGGCTGGCTTCCAACTCCTGG - Intronic
1162835068 19:13311298-13311320 CTGGGCTGGTTTTCAACTCCTGG + Intronic
1163466843 19:17472867-17472889 GTGGACCAGCCTCCATCTCCTGG + Intronic
1164788702 19:30958165-30958187 GCTGGCTGGCTTCCAGGTCCTGG - Intergenic
1165030715 19:32996220-32996242 GGGTGCTGGCTTCCGTCTGCAGG - Exonic
1165971148 19:39631246-39631268 CTGGGCTGGCTTTGAACTCCTGG - Intergenic
1167704355 19:51070164-51070186 CTGGGCATGCTTCCATCTCAGGG + Intergenic
1167705752 19:51079915-51079937 TTGGGCTGGGCTCCAGCTCCTGG + Intronic
926156364 2:10456250-10456272 GCGGGCTGGCTTCCCTCTGAGGG - Intergenic
926732004 2:16042564-16042586 TTGGGCTGGAATCCATCCCCTGG - Intergenic
927489178 2:23509324-23509346 TGGGGCTGGCTGCCATGTCCAGG + Intronic
931340993 2:61400638-61400660 CTGGGCTGGCTTTGAGCTCCTGG - Intronic
931737554 2:65210834-65210856 CTGGGCTGGTCTCCAACTCCTGG + Intergenic
932567325 2:72918038-72918060 GGGCGCGGGCTCCCATCTCCTGG + Exonic
932571054 2:72938583-72938605 GCTGGCTGGCTTCCACCACCAGG - Intergenic
933031662 2:77336004-77336026 GTGGGCTGGATTTCATCTGCAGG + Intronic
933588602 2:84207097-84207119 GTGGGCAGGCCTGCATCTGCAGG - Intergenic
935055346 2:99561585-99561607 CTGGGCTGGTTTCAAACTCCTGG + Intronic
935250481 2:101255926-101255948 CCAGGCTGGCTTCCAACTCCTGG - Intronic
940512016 2:154627530-154627552 GTGGGCTGGTCTCAAGCTCCTGG + Intergenic
940861561 2:158775337-158775359 CCAGGCTGGCTTCCAACTCCTGG - Intergenic
941715902 2:168763083-168763105 CTGGGCTGGTTTCAAACTCCTGG + Intronic
942656018 2:178214734-178214756 CTAGGCTGGCTTCAAACTCCTGG - Intronic
943100351 2:183479326-183479348 GGGGGCTGCCCCCCATCTCCTGG - Intergenic
944805828 2:203280229-203280251 CTGAGCTGGCCTCCAACTCCTGG - Intronic
944850802 2:203717054-203717076 CCAGGCTGGTTTCCATCTCCTGG + Intronic
947558474 2:231121316-231121338 CTGGGCTGGCCTCAAACTCCTGG - Intronic
947653826 2:231809484-231809506 GTGGACTGGCCTCAAACTCCCGG - Intergenic
948278795 2:236730651-236730673 GTGGCCTGGCTCACATCCCCGGG + Intergenic
948505449 2:238424596-238424618 GTGGGCTGTCTTGCCCCTCCAGG - Intergenic
948626106 2:239269082-239269104 CTTGGATGGCTTCCATCTGCTGG - Intronic
948673296 2:239582155-239582177 GCAGGCTGCCTTCCCTCTCCAGG - Intronic
949005165 2:241641834-241641856 GTGGTCTGCCTGCCACCTCCTGG - Intronic
1169064539 20:2687353-2687375 CTGGGCTGGTCTCGATCTCCTGG + Intergenic
1169363352 20:4970521-4970543 CTAGGCTGGTTTCCAACTCCTGG - Intronic
1170463031 20:16596860-16596882 GTGGCCTGACTCCCACCTCCTGG + Intergenic
1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG + Intergenic
1170845093 20:19955544-19955566 ACGGGCTGGCTTCAAACTCCTGG + Intronic
1171722477 20:28578003-28578025 CTAGGCTGGTTTCCAGCTCCTGG + Intergenic
1171755605 20:29105447-29105469 CTAGGCTGGTTTCCAACTCCTGG - Intergenic
1171787074 20:29477438-29477460 CTAGGCTGGTTTCCAACTCCTGG + Intergenic
1171860891 20:30401948-30401970 CTAGGCTGGTTTCCAACTCCTGG - Intergenic
1171960610 20:31491369-31491391 TCGGGCTGGCTTCAAACTCCTGG + Intergenic
1172244489 20:33436624-33436646 CTGGGCTGGTCTCCAACTCCTGG - Intronic
1172515724 20:35531546-35531568 CTAGGCTGGTCTCCATCTCCTGG + Intergenic
1174025027 20:47566907-47566929 CCAGGCTGGCTTCCAACTCCTGG - Intronic
1174065242 20:47860009-47860031 GCAGGATGGCTACCATCTCCTGG - Intergenic
1174618195 20:51852776-51852798 GCAGGCTGGCCTCCAACTCCTGG + Intergenic
1177144955 21:17397619-17397641 TTAGGCTGGCTTCAAACTCCTGG - Intergenic
1178695346 21:34787959-34787981 GTGGGCCGCCTCCCCTCTCCTGG - Exonic
1180011829 21:45056213-45056235 GTCATCTGGCTTCCATCTCTGGG + Intergenic
1180296028 22:10936687-10936709 CTAGGCTGGTTTCCAGCTCCTGG + Intergenic
1180412647 22:12629322-12629344 CTAGGCTGGCTTCCAACTCCTGG - Intergenic
1180794784 22:18597450-18597472 CTGTGCTGGTTTCCAACTCCTGG - Intergenic
1180983035 22:19888276-19888298 GGTGGCTGCCCTCCATCTCCTGG - Intronic
1181226955 22:21397873-21397895 CTGTGCTGGTTTCCAACTCCTGG + Intergenic
1181251694 22:21536970-21536992 CTGTGCTGGTTTCCAACTCCTGG - Intergenic
1181434021 22:22900037-22900059 GTTACCTGGGTTCCATCTCCTGG + Intergenic
1181434959 22:22905403-22905425 GTTACCTGGGTTCCATCTCCTGG + Intergenic
1181475917 22:23167755-23167777 CTGGGCTGGCCTCAAACTCCCGG + Intergenic
1181541803 22:23577327-23577349 CTGGGCTGGCCTCCAACTGCTGG - Intronic
1181618992 22:24074981-24075003 CTGGGCTGGCTTCAAACTCCTGG - Intronic
1181805730 22:25373535-25373557 GTGGGCTGGCTTCCAACTCAGGG - Intronic
1182079077 22:27516410-27516432 CTGGGCTGGCTTACATTTCCAGG - Intergenic
1182099389 22:27647093-27647115 CTGGGCTGGCCTCGAACTCCTGG + Intergenic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1183297179 22:37037242-37037264 GTGGGCTGGCTGGGAGCTCCGGG + Intergenic
1183667433 22:39253839-39253861 GGGGGCTGCCTTCCTTCCCCAGG + Intergenic
1184010967 22:41748074-41748096 GTGGGCTGTGTTCTCTCTCCTGG + Intronic
1184232530 22:43166365-43166387 GTGGGGAGGCTGCTATCTCCAGG + Intergenic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1184849595 22:47112649-47112671 CCGGGCTGGGTTCCATCTGCTGG - Intronic
1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG + Intergenic
1185275321 22:49948127-49948149 CAGGGCTGGCTTCCATCAGCAGG - Intergenic
1185307372 22:50127516-50127538 CTGGGATGGCTTCCAGCTCCGGG - Intronic
949511186 3:4768633-4768655 GTGGCCTGGGTGCCCTCTCCAGG - Exonic
949769631 3:7565580-7565602 GTCAGCTGGCTTCACTCTCCTGG - Intronic
950430051 3:12945332-12945354 GTGGCCGGGCCTCCCTCTCCAGG + Intronic
953531386 3:43742572-43742594 CTAGGCTGGCCTCAATCTCCTGG + Intergenic
954021133 3:47742790-47742812 CTGGGCTGGGTTCAAACTCCTGG + Intronic
954187001 3:48925037-48925059 CTAGGCTGGCCTCAATCTCCTGG + Intronic
954936888 3:54334677-54334699 GTGTGATTGCTTCCATCTCAAGG - Intronic
956301245 3:67774993-67775015 GTGGGGTGGCTGCCCTCCCCTGG + Intergenic
956425994 3:69135719-69135741 TTTGGGTGGCTTCCATCTCTTGG - Intergenic
956611348 3:71126612-71126634 CTGGGCTGGTCTCCAACTCCTGG - Intronic
956830741 3:73045210-73045232 CCAGGCTGGCTTCCAACTCCTGG + Intronic
960901075 3:122555076-122555098 CTAGGCTGGCCTCCAACTCCTGG + Intronic
960968575 3:123123063-123123085 CCAGGCTGGCTTCCAACTCCTGG - Intronic
961512329 3:127410692-127410714 GTGGGCTGGTGGCCACCTCCTGG - Intergenic
961747753 3:129076226-129076248 CCGGGCTGGTTTCCAACTCCTGG - Intergenic
962807234 3:138936433-138936455 GCGGGCTCCCTTCCAGCTCCCGG + Intergenic
965039676 3:163490406-163490428 GTGGGTTGGCTGCCCTCTGCTGG + Intergenic
965929152 3:174021214-174021236 ATTAGCTGGCTTCCATCTCTTGG + Intronic
966790844 3:183667920-183667942 CTGGGCTGGTTTCAAACTCCTGG + Intronic
967225936 3:187291444-187291466 GTGGGCTGGGTGCCTTCCCCAGG - Intronic
968211797 3:196855049-196855071 CTGGGCTGGTCTCCAACTCCTGG + Intergenic
968617585 4:1585944-1585966 TTGGGCTGGCTTTGAACTCCTGG + Intergenic
968910421 4:3474468-3474490 GTGGTCTGGTCTCTATCTCCTGG - Intronic
969271298 4:6105149-6105171 ATGAGCAGACTTCCATCTCCAGG - Intronic
972666046 4:41166324-41166346 CTGGGCTGGTTTCAAACTCCTGG - Intronic
973021079 4:45207081-45207103 CTGGGCTGGTCTCCAGCTCCTGG + Intergenic
973028781 4:45309511-45309533 GTGGGCTGCATTCCTTCTCAAGG - Intergenic
973077890 4:45953423-45953445 CTGGGCTGGCCTCTAACTCCTGG + Intergenic
973264503 4:48198035-48198057 GAGGGCAGTCCTCCATCTCCGGG - Intronic
973951990 4:56025188-56025210 CTGGGCTGGCCTCAAACTCCTGG + Intronic
976046687 4:80956655-80956677 CTGGGCTGGTCTCCAACTCCTGG + Intronic
976641419 4:87342495-87342517 CTAGGCTGGTTTCCAACTCCTGG - Intronic
980133568 4:128839266-128839288 CTGCTCTGCCTTCCATCTCCAGG - Intronic
980513492 4:133823759-133823781 GTGGGATGGAGTCAATCTCCTGG - Intergenic
981067132 4:140497691-140497713 GTGGTCTGGGTTACATCACCAGG - Intronic
981183882 4:141778777-141778799 CTAGGCTGGTCTCCATCTCCTGG + Intergenic
982490928 4:156028744-156028766 CTGGGCTGGTCTCCAGCTCCTGG - Intergenic
986690299 5:10308096-10308118 GCTGGCTGTCTTCCTTCTCCTGG - Intergenic
988906260 5:35793508-35793530 GAAGCCTGGCTTCCATCCCCAGG + Intronic
989083236 5:37648294-37648316 TTTGGCTGGGTTCTATCTCCAGG + Intronic
989231816 5:39095647-39095669 CTGGGCTGACTTCTAACTCCTGG - Intergenic
989344341 5:40412247-40412269 GTGGTCTGGTGTCAATCTCCAGG - Intergenic
989655798 5:43745909-43745931 GGGGGCTGGCCCCCACCTCCCGG + Intergenic
990087981 5:52002625-52002647 GTGGGCTGGCATCATTCTCCAGG + Intergenic
991662046 5:68960386-68960408 GATTGCTGGGTTCCATCTCCAGG - Intergenic
995038630 5:107563648-107563670 TTAGGCTGGCCTCCAGCTCCCGG + Intronic
995869475 5:116729390-116729412 GTGGGGAGGCTTCCATCAGCTGG + Intergenic
997794709 5:136796936-136796958 GTATGCTGGCTTTCTTCTCCTGG + Intergenic
998118127 5:139554241-139554263 CTAGGCTGGCTTCAAACTCCTGG + Intronic
1001081795 5:168672681-168672703 CTAGGCTGGCCTCCAACTCCTGG + Intronic
1001505984 5:172281107-172281129 CTGGGCTGGTCTCCAACTCCTGG + Intronic
1001534363 5:172488423-172488445 TCTGCCTGGCTTCCATCTCCAGG + Intergenic
1001635786 5:173209227-173209249 CTGGGCTGGTTTCAAACTCCCGG - Intergenic
1002060585 5:176623481-176623503 GAGGCCTGGCCTCCGTCTCCTGG + Intronic
1002689879 5:181043432-181043454 GGGGGCAGGCTGCCACCTCCTGG - Intronic
1003126060 6:3356694-3356716 ATGGGCTGGCTTGAACCTCCAGG + Intronic
1003823192 6:9923396-9923418 CTAGGCTGGCCTCCAACTCCTGG - Intronic
1003854786 6:10262327-10262349 CTGGGCTGGACTCCAACTCCTGG - Intergenic
1004465675 6:15882840-15882862 ATGGGCTGGATTCCAGCCCCTGG + Intergenic
1004673187 6:17816525-17816547 CTGGGCTGGATTCAAACTCCTGG + Intronic
1004984424 6:21064855-21064877 GTTGGCTGCCTGCCATTTCCAGG - Intronic
1006103871 6:31704155-31704177 CTGGGCTGGCTTGGAACTCCAGG - Intronic
1006178315 6:32137425-32137447 CTGGGCTGGTCTCAATCTCCAGG + Intergenic
1006576738 6:35052103-35052125 CTGGGCTGGTTTCAAACTCCTGG - Intronic
1006615446 6:35323087-35323109 CTCGGCTGGCCTCCAACTCCCGG + Intergenic
1006823301 6:36915530-36915552 CTGGGCTGGTCTCCAACTCCCGG - Intronic
1007031125 6:38627785-38627807 TTAGGCTGACTTTCATCTCCAGG + Intronic
1007784882 6:44273997-44274019 GTGGGCTGGTCTCAAACTCCTGG - Intronic
1008651863 6:53572250-53572272 CTGGGTTGGTTTCCAACTCCTGG + Intronic
1008716541 6:54295848-54295870 TTGGACTGGCTGCCATCTCATGG + Intergenic
1008947834 6:57118691-57118713 CTGGGCTGGTCTCCAACTCCTGG + Intronic
1009869284 6:69433848-69433870 CTGGGCTGGTCTCCAGCTCCTGG - Intergenic
1011451554 6:87497936-87497958 TTGGGCTGGTCTCCAACTCCTGG + Intronic
1012235005 6:96803315-96803337 GTGGGTAGGCTTCCATATACAGG - Intronic
1012641772 6:101626398-101626420 TTGGGGTGGCTGCCATCTTCGGG + Exonic
1013084622 6:106845968-106845990 TCAGGCTGGCCTCCATCTCCTGG - Intergenic
1013201656 6:107903489-107903511 CTGGTCTGGTTTCCAACTCCTGG - Intronic
1016809512 6:148245912-148245934 CTGGGCTCACCTCCATCTCCCGG - Intergenic
1016945429 6:149528044-149528066 GTGGGCTGGTCTCAAACTCCTGG - Intronic
1016965608 6:149716278-149716300 CTGCGCTGGATTCCAACTCCTGG - Intronic
1018088462 6:160325461-160325483 GTGGGTTGGCTGTCATCACCGGG + Intergenic
1019006081 6:168797623-168797645 CTGGGCTGGTCTCCAACTCCTGG - Intergenic
1019773962 7:2901381-2901403 CTTGGCTGGCTTCCACCTTCTGG + Intergenic
1019822592 7:3256667-3256689 CTAGGCTGGCCTCCAACTCCTGG - Intergenic
1020234127 7:6342333-6342355 CTGGGCTGGTCTCCAGCTCCTGG - Intronic
1020262650 7:6539334-6539356 GTGGGCTGGTCTTCAACTCCTGG + Intronic
1021592564 7:22279922-22279944 TTGGGATGGCCTCCATTTCCAGG + Intronic
1025147624 7:56518474-56518496 GTTGGCTGGTCTCCAACTCCTGG + Intergenic
1026019789 7:66697988-66698010 GGGAGCTGGCTTCAAACTCCTGG - Intronic
1026506894 7:70992463-70992485 CTAGGCTGGTTTCCAACTCCTGG + Intergenic
1026880575 7:73904579-73904601 GGGAGCTGGCTTCGAACTCCTGG + Intergenic
1026911312 7:74093360-74093382 GTGGGTCGGCTTCCAGCCCCAGG - Intronic
1031963082 7:128007084-128007106 GAGAGCTGGCTGCCTTCTCCAGG - Intronic
1033050960 7:138003609-138003631 CTGGGCTGGCCTCAAACTCCTGG + Intronic
1033141316 7:138829412-138829434 GCGGGCTGGTCTCGATCTCCTGG - Intronic
1033601671 7:142893167-142893189 GTGGGCTGGCTCCCCAATCCAGG + Intergenic
1034259934 7:149748700-149748722 TTGGGCTGGGTTCCCTCTCCTGG + Intergenic
1034896197 7:154877947-154877969 CTGGGCCGGCTTCCGTGTCCTGG - Intronic
1035085972 7:156258254-156258276 AAGGGCTGGCTTCCATCCTCAGG - Intergenic
1035233333 7:157479859-157479881 CCAGGCTGGCCTCCATCTCCTGG + Intergenic
1036367819 8:8136370-8136392 CCAGGCTGGCTTCCAACTCCTGG + Intergenic
1036808792 8:11853245-11853267 GAGGGCTGGCTTCCCATTCCTGG + Intronic
1036883064 8:12529280-12529302 CCAGGCTGGCTTCCAACTCCTGG - Intergenic
1037740187 8:21602648-21602670 ATGGGCTGGCTTTCATTTCCAGG + Intergenic
1037771135 8:21800713-21800735 CTGGGCTGGCCTCCAACTCCTGG - Intronic
1039236503 8:35508016-35508038 GTGAGAGGGCTTCCAACTCCAGG - Intronic
1039650884 8:39339195-39339217 GGGGGCTGCCCCCCATCTCCCGG + Intergenic
1040900826 8:52415315-52415337 CTGGGCTGGTCTCCACCTCCTGG - Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1042055098 8:64755976-64755998 GTGGGCTGGCTTTGACCTGCAGG + Intronic
1043414756 8:80035264-80035286 GTTGGCTGACCTCCAACTCCTGG - Intronic
1043768200 8:84163880-84163902 CTGGGCTGGCCTCGAACTCCTGG + Intergenic
1045338287 8:101228795-101228817 CCGGGCTGGCCTCCAACTCCTGG + Intergenic
1045962250 8:107981783-107981805 GTTGGCTGGTTTCTAACTCCTGG - Intronic
1046646411 8:116791017-116791039 TTGGGCTGGTCTCCAACTCCAGG + Intronic
1047206163 8:122804316-122804338 TTAGGCTGGTTTCCAACTCCTGG + Intronic
1047920273 8:129628285-129628307 GCAGGCTGGCTGCCTTCTCCTGG - Intergenic
1047979965 8:130170923-130170945 TTGGGCTGGTCTCCAACTCCTGG + Intronic
1048574722 8:135681512-135681534 GTGTGCTGGGTTCAATGTCCTGG - Intergenic
1049024406 8:139978997-139979019 GTGGCCGGGCTCCCATCCCCAGG + Intronic
1049367006 8:142244674-142244696 TTGGGCTGGCCTCCACCTCCCGG - Intronic
1050237571 9:3597840-3597862 ATGGGGTGGCTTCCCTCTGCTGG - Intergenic
1051643052 9:19241420-19241442 TTAGGCTGGCCTCCAACTCCTGG + Intronic
1052306620 9:27017429-27017451 CTGGGCTGGTCTCCAGCTCCTGG + Intronic
1053187951 9:36034955-36034977 CTGGGCTGGCCTCAAACTCCTGG + Intergenic
1054154355 9:61629641-61629663 GTGGGCTTCCCTCCACCTCCTGG - Intergenic
1055049969 9:71969349-71969371 CTGGGCTGGTCTCAATCTCCTGG + Intronic
1055805354 9:80087063-80087085 GTGGGCAGCCTTCCCTCTACAGG + Intergenic
1059189677 9:112312832-112312854 CTGGGCTGGTCTCCAACTCCTGG - Intronic
1059246764 9:112855834-112855856 AGGGGCTGGCTGCCTTCTCCTGG + Intronic
1059473684 9:114526671-114526693 CTGGTCTGGCTTGCATGTCCTGG - Intergenic
1060207746 9:121692592-121692614 GTAGTCTGGCTACCTTCTCCAGG + Intronic
1060606122 9:124915638-124915660 CTGGGCTGGTTTTGATCTCCTGG - Intronic
1061553083 9:131349187-131349209 CCAGGCTGGCCTCCATCTCCTGG - Intergenic
1061850185 9:133410394-133410416 GAGGGCAGCCTGCCATCTCCTGG - Intronic
1203447673 Un_GL000219v1:74922-74944 CTAGGCTGGTTTCCAACTCCTGG + Intergenic
1186355560 X:8785733-8785755 CTAGGCTGGTTTCCAACTCCTGG - Intergenic
1186648304 X:11531413-11531435 GGGGACTGGCTGCCCTCTCCTGG + Intronic
1187862372 X:23694724-23694746 GTGGGCTGGGTGCCATCTTGTGG - Intergenic
1190131383 X:47751873-47751895 GTGGGGTGGCTGCCCTCTGCTGG + Intergenic
1190181708 X:48197846-48197868 CCAGGCTGGCTTCAATCTCCTGG + Intronic
1191737249 X:64399842-64399864 CTAGGCTGGTTTCCAACTCCTGG + Intergenic
1192489747 X:71565436-71565458 CTAGGCTGGCCTCCAACTCCTGG + Intronic
1195021762 X:100835354-100835376 GTAGGCGGGCCTCCAACTCCTGG - Intronic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic
1198540112 X:137629026-137629048 CTGGGCTGGCCTCAAACTCCTGG + Intergenic
1199724223 X:150565903-150565925 GATGGCTGGCCTCCCTCTCCAGG - Intergenic
1202378154 Y:24256482-24256504 GATGCCTTGCTTCCATCTCCTGG - Intergenic
1202492628 Y:25413639-25413661 GATGCCTTGCTTCCATCTCCTGG + Intergenic