ID: 1198223243

View in Genome Browser
Species Human (GRCh38)
Location X:134622224-134622246
Sequence AATCCTGCCTTGGTGCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198223240_1198223243 16 Left 1198223240 X:134622185-134622207 CCACAATGTTGTTTAGAAAAAAG 0: 1
1: 0
2: 3
3: 38
4: 373
Right 1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG 0: 1
1: 0
2: 4
3: 13
4: 185
1198223239_1198223243 25 Left 1198223239 X:134622176-134622198 CCGAGACAGCCACAATGTTGTTT 0: 1
1: 0
2: 3
3: 15
4: 185
Right 1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG 0: 1
1: 0
2: 4
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198223243 Original CRISPR AATCCTGCCTTGGTGCTGAG CGG Intronic
902617582 1:17632229-17632251 AATCCTCCCATGGTGCAGAAAGG - Intronic
903035208 1:20488368-20488390 GCTCCTTCCTTGCTGCTGAGAGG + Intergenic
903815144 1:26059422-26059444 AATCCAGTCTTGGTCCTGAAAGG - Intronic
905876185 1:41433320-41433342 GATACTGCCTTGGGCCTGAGTGG + Intergenic
908393640 1:63705611-63705633 AATCCTGACTTGGGGCAAAGAGG - Intergenic
909015008 1:70371410-70371432 TAGCCTGCCTTGCTGGTGAGTGG - Intronic
910349968 1:86285077-86285099 ATTCTTGCCTTGTTCCTGAGTGG - Intergenic
910451331 1:87349036-87349058 TGTCCTGCCCTGGTTCTGAGGGG - Intergenic
910920068 1:92335233-92335255 ACTCCAGCCTGGGTGCTGAAGGG + Intronic
913532000 1:119740256-119740278 ACTCCTGCCTTGGTGCCTGGTGG - Intronic
914919983 1:151839884-151839906 AATGCTGCCTTTGTGCTCGGTGG - Intronic
915140267 1:153763603-153763625 AATCCTGCCTTGGTTCTCAGAGG - Intronic
917837745 1:178954165-178954187 CATTCTACCTTGGTCCTGAGCGG - Intergenic
918211699 1:182357233-182357255 AACCCTGACTTGGTGTTCAGTGG + Intergenic
918318200 1:183340696-183340718 ATATCTGCCTGGGTGCTGAGAGG + Intronic
921198775 1:212783660-212783682 AATCTTCCCTTGGTGGGGAGGGG - Intronic
921724681 1:218510729-218510751 AATTCTGCTTTGATGCTAAGAGG + Intergenic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
922962670 1:229662074-229662096 AGACCTGCCTGGGTGGTGAGAGG + Intergenic
923481409 1:234388569-234388591 AATTTTTCCTTAGTGCTGAGTGG - Intergenic
923674011 1:236064898-236064920 TCTCCTGCCCTGGAGCTGAGTGG - Exonic
923756656 1:236797074-236797096 AAGCCAGCCTTGGGGGTGAGGGG - Intronic
1063383985 10:5604452-5604474 AAGCCATCCTTGGTGCTGCGTGG + Intergenic
1065295063 10:24266445-24266467 CATTCAGCCATGGTGCTGAGAGG + Intronic
1070502662 10:77086409-77086431 AGTCCTGACTCTGTGCTGAGGGG - Intronic
1072915261 10:99533743-99533765 ACTGCTGCCCTGATGCTGAGAGG + Intronic
1076461145 10:130648535-130648557 CATCCAGCCTGGGTGCTGTGTGG + Intergenic
1076746337 10:132516774-132516796 GATCCTGCCTTTGAGGTGAGGGG - Intergenic
1080788090 11:35494232-35494254 AAGCCTGCCCTGGAGCAGAGTGG - Exonic
1081864150 11:46350525-46350547 CATCCAGCCTTGGGGTTGAGGGG + Intronic
1083491453 11:63017426-63017448 GATACTGCCTTGGTGGAGAGGGG - Intergenic
1084641839 11:70430890-70430912 AATCCTGCCTAGGTGCTGGTGGG + Intronic
1084641856 11:70430949-70430971 GATCCTGCCTGGGTGCTGGTGGG + Intronic
1087179907 11:95131570-95131592 AATCTTGCCATGGTCCAGAGAGG - Exonic
1089554038 11:119305121-119305143 ACTCCTGCCTTTTTGCTTAGTGG + Exonic
1089581490 11:119484214-119484236 AGTCCTGCCTTGGTGTTGCTGGG + Intergenic
1090811033 11:130243541-130243563 AAACCTGCCTTGGCAATGAGCGG - Intronic
1091301461 11:134510618-134510640 CATCCTGCCTGGGGGCTGAAGGG + Intergenic
1092255246 12:6923503-6923525 AAGCCTGCGTTGGTCCAGAGCGG + Exonic
1098429991 12:70408618-70408640 AATCCTTCCTGGGTGTAGAGAGG - Intronic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102584543 12:113914019-113914041 ATTCATGGCTTGGTGCTGGGTGG + Intronic
1102655772 12:114481136-114481158 TTTCCTGCCCTGGTGCTAAGAGG + Intergenic
1103020337 12:117528776-117528798 AATCACGCCTTGATGCAGAGAGG - Intronic
1103635804 12:122304130-122304152 AATCCTGCGGTGGTGCAAAGGGG + Intronic
1104734214 12:131126986-131127008 AATCCTGCATCGGTGCGGTGGGG - Intronic
1104738820 12:131157730-131157752 AATCATGCCTTGGTGAAGTGGGG + Intergenic
1113135477 13:107084145-107084167 AATGCTGCCTTGGAGGTCAGAGG + Intergenic
1113766630 13:112885732-112885754 CATCCTGCCTCCTTGCTGAGGGG + Exonic
1118623553 14:67635960-67635982 CATCCTCACTTGGTGCTGAGAGG - Intronic
1119196601 14:72721685-72721707 AATCCTTCCTAGGTGGTGATAGG - Intronic
1119549252 14:75496536-75496558 ACTCCAGCTTTGGTGTTGAGAGG - Intergenic
1119907469 14:78318841-78318863 AATGCAACCTTGGTGCTAAGAGG - Intronic
1123458670 15:20448041-20448063 AATCCTGTCTTGGGGGTGGGTGG - Intergenic
1123659392 15:22552374-22552396 AATCCTGTCTTGGGGGTGGGTGG + Intergenic
1124264957 15:28224216-28224238 AATCCTGTCTTGGGGGTGGGGGG - Intronic
1124313256 15:28646865-28646887 AATCCTGTCTTGGGGGTGGGTGG + Intergenic
1126352940 15:47764110-47764132 AAGCCTGTCTTGGTTCTGACAGG - Intronic
1127536350 15:59893380-59893402 AATCCAGCCTTGGCACTGTGAGG + Intergenic
1128788465 15:70415426-70415448 AATCCCGCCTTGGTGAGGGGAGG - Intergenic
1130686826 15:86045237-86045259 AAGCCTCCCTTGATGCTGAGTGG + Intergenic
1131270819 15:90946702-90946724 AACCGGGCCTTGGAGCTGAGCGG + Exonic
1131423538 15:92326844-92326866 AGTCCTGCCTGAGGGCTGAGGGG + Intergenic
1133955937 16:10443936-10443958 AGTCCAGCCTTGGTACTGAGTGG + Intronic
1136490073 16:30602001-30602023 AACACTGCATTGCTGCTGAGAGG - Intergenic
1136703101 16:32161332-32161354 AATCCTGTCTTGGGGGTGGGGGG - Intergenic
1136764598 16:32766266-32766288 AATCCTGTCTTGGGGGTGGGGGG + Intergenic
1136803501 16:33104118-33104140 AATCCTGTCTTGGGGGTGGGGGG - Intergenic
1137719314 16:50618682-50618704 CATCCTGCCCTGGGGCTGTGGGG - Intronic
1139538892 16:67599014-67599036 AATCGTGCATTGGGGTTGAGGGG + Intronic
1140120976 16:72082707-72082729 AGTCCAGCCTTGGGACTGAGTGG - Intronic
1203066955 16_KI270728v1_random:1028391-1028413 AATCCTGTCTTGGGGGTGGGGGG + Intergenic
1143628611 17:8124475-8124497 AATTCAGCCTGGGGGCTGAGAGG - Intergenic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1145311170 17:21701876-21701898 ATTCCAGCCTAGGTGATGAGAGG + Intronic
1145997667 17:29113820-29113842 AAGACTGCCTGAGTGCTGAGGGG + Intronic
1147416449 17:40294035-40294057 AATTCTCACTTGGTGCTGATTGG + Exonic
1148052779 17:44777290-44777312 ACACCTGCCCTGGAGCTGAGAGG - Intronic
1148324178 17:46773646-46773668 GGTACTGCCTTGGGGCTGAGGGG - Exonic
1149327413 17:55546279-55546301 ACTTCTGCCTTGTAGCTGAGAGG + Intergenic
1149363888 17:55921460-55921482 AATCCTGCCTCTATCCTGAGTGG + Intergenic
1151723743 17:75873146-75873168 ACTCCTGCCTGGGTTCTGTGTGG - Intergenic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1153263436 18:3246097-3246119 AATGCTGCCTTCAAGCTGAGGGG + Intergenic
1153628940 18:7050411-7050433 ATTCTTGCCCTGGTGCTGTGGGG + Intronic
1158611485 18:58944576-58944598 ACCCCTGCCTTTGTGCAGAGTGG + Intronic
1160199060 18:76781129-76781151 AACCTTGCCATGCTGCTGAGTGG - Intergenic
1160566025 18:79787254-79787276 AGGCCTGCTTAGGTGCTGAGAGG + Intergenic
1161242271 19:3228939-3228961 ACTCCTGCCGGGGTGCTGTGTGG + Intronic
1163233663 19:16019387-16019409 CAACCTGCCTTGGTGCTGAGAGG + Intergenic
1163555876 19:17992726-17992748 AATCCTGCCGGGGTGCGGATGGG + Intronic
1165310473 19:35026526-35026548 GATCCTGCCATGGTGGGGAGGGG + Intergenic
1167288502 19:48612280-48612302 ACCCCTGGCTTGGTGATGAGGGG + Intronic
1167816981 19:51891642-51891664 AATTGTGACTTGGTGCTGATGGG + Exonic
925134307 2:1515681-1515703 AATCATGCCCAGGTGCTAAGTGG + Intronic
926334640 2:11854007-11854029 CATCCTACCTAGATGCTGAGAGG - Intergenic
926334670 2:11854179-11854201 CATCCTACCTAGATGCTGAGAGG - Intergenic
929577265 2:43059751-43059773 AATCCAGCCACGGTACTGAGAGG - Intergenic
936036636 2:109118111-109118133 TATCCAGCCTTTGGGCTGAGTGG + Intergenic
937023427 2:118678942-118678964 AAGCCTTCCTTAGTGCTGAAGGG + Intergenic
938048202 2:128141776-128141798 ACTCCAGCCTGGGTGATGAGTGG + Intronic
943107384 2:183562413-183562435 AGTCCTGACTTTGTACTGAGTGG + Intergenic
943654459 2:190492837-190492859 AGTGCTGGCTTGGTGGTGAGTGG - Intronic
947496048 2:230637984-230638006 ACTCCTGCCTAGGTGATGACAGG + Intergenic
948119260 2:235516735-235516757 AAGCCTGCCGGGGAGCTGAGTGG - Intronic
948336747 2:237214270-237214292 AATCCAGCTTTGGCCCTGAGAGG - Intergenic
1173293924 20:41739060-41739082 AATCCAGCCTTGCTGCTGGAGGG - Intergenic
1173440027 20:43067930-43067952 ATTCCAGCCTGGGTGATGAGGGG + Intronic
1174359242 20:50017505-50017527 CATCCTGCCTTGTTGAGGAGAGG + Intergenic
1174421514 20:50402020-50402042 CTTCCTGCCTTGGTGGTGAGGGG + Intergenic
1174570074 20:51495115-51495137 ACTCCAGCCTGGGTGATGAGTGG - Intronic
1177628351 21:23694735-23694757 AAACATGCCTTTGTCCTGAGAGG - Intergenic
1178374477 21:32055500-32055522 AATCCTGCTTTGCTTCTCAGAGG - Intergenic
1180673262 22:17569821-17569843 AACCCTGCAGTGGTGATGAGGGG + Intronic
1181116543 22:20635456-20635478 TACCCTGCCCTGGTGCTGTGGGG - Intergenic
950116573 3:10454294-10454316 AATCCCTACTTGGAGCTGAGAGG - Intronic
950973545 3:17215291-17215313 GATCATGACTTGGTGGTGAGAGG + Intronic
953021986 3:39120494-39120516 AATCTTGCTTTGGGGCTGAAGGG - Intronic
954329462 3:49881845-49881867 AACCCTCTCTTGGTGCTGATGGG + Intergenic
954627190 3:52028967-52028989 AGTCCTGCCTTGAGTCTGAGGGG - Intergenic
957318512 3:78599209-78599231 AATGTTGACTTGGGGCTGAGGGG - Intronic
958629992 3:96672215-96672237 AATATTGCCTTTGTGCTCAGGGG + Intergenic
958897738 3:99848408-99848430 TATCCTGCAGTGGTGCTGAAGGG + Exonic
959952668 3:112197500-112197522 CTGCCTGCCATGGTGCTGAGGGG + Intronic
961433965 3:126903631-126903653 AGCCCTGCCTTGGTGCTGCTGGG - Intronic
961557757 3:127708291-127708313 AGTCCAGCCTTGGGGCTGACCGG + Intronic
968496730 4:922210-922232 GATGCTGCCTTTTTGCTGAGGGG - Intronic
971570201 4:28202817-28202839 AATCCTGTTTTGGTCCTGAAGGG - Intergenic
974662786 4:64915990-64916012 AATCTTGCCTTGGTCTTCAGAGG + Intergenic
974840222 4:67290804-67290826 TATTCTTCCTTGGTGCTGAGGGG - Intergenic
979519416 4:121649465-121649487 AAGCCTGCCTTCCTGCTCAGGGG + Intergenic
985268701 4:188174489-188174511 AACACTGCCTTGGGGGTGAGTGG + Intergenic
986050053 5:4081656-4081678 ATGCCTGCCTTCCTGCTGAGAGG + Intergenic
991769518 5:70027320-70027342 AATCCAGCCTGGGTACTGAGCGG + Intronic
991848813 5:70902738-70902760 AATCCAGCCTGGGTACTGAGCGG + Intronic
992907108 5:81357423-81357445 AGTCTTTCCTTGCTGCTGAGAGG + Intronic
993092211 5:83440499-83440521 AATCCTGCCTTGTTTCTCATGGG - Intergenic
993393323 5:87350066-87350088 AATACTGCTGTGGTACTGAGGGG - Intronic
998347222 5:141475707-141475729 AAGCCAGCCTTGGGGCTGTGAGG - Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999899964 5:156076447-156076469 AATCCTTCTTTTGTACTGAGAGG - Intronic
1001210918 5:169809490-169809512 AATTCTGCCTGGGGGCAGAGCGG - Intronic
1001272802 5:170328284-170328306 AATCCTGGCTTCATGCTGTGTGG - Intergenic
1002280522 5:178127431-178127453 AACCTTGCCTTGGTGCCAAGGGG - Intergenic
1002454331 5:179337741-179337763 AAGCCAGCCTCGCTGCTGAGCGG + Intronic
1002708651 5:181180551-181180573 CATCCTGTCTAGGTGCTAAGGGG - Intergenic
1003035787 6:2639274-2639296 AGTCCTGCCTAGGTGATGTGTGG + Intergenic
1003263929 6:4549946-4549968 AATCCTGCCTTGAAGCTCACAGG + Intergenic
1005482173 6:26265294-26265316 AAACCTGCTTTGGTGCTGCCAGG - Intergenic
1005918761 6:30379545-30379567 ACAGCTGCCTTGGTGCTGAGTGG - Intergenic
1006175014 6:32116414-32116436 GATCCAGCCTGGGAGCTGAGGGG - Intronic
1007331469 6:41113284-41113306 AATCCTGCGTTGTTTCTGTGAGG - Intergenic
1007516903 6:42419798-42419820 ACTCCTGCCGTGGTGTTGACTGG + Intronic
1007962156 6:45969750-45969772 AATCCTGCCTTGTTATTGAATGG + Intronic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1012357766 6:98337348-98337370 AATTCTGCCATTGTGCTGAGTGG + Intergenic
1014841122 6:126221368-126221390 AATGCTGATTTGGTGCTGATGGG - Intergenic
1016712565 6:147190375-147190397 AATGCTGCCATGGTGGTGAATGG - Intergenic
1017527209 6:155252079-155252101 AGCCCAGCCTTGGTGCTCAGTGG - Intronic
1019219443 6:170462733-170462755 ATTCCTGCCTTGGGGCTGCTTGG + Intergenic
1020314748 7:6897630-6897652 AAGTCTCCCTTGCTGCTGAGGGG - Intergenic
1021912001 7:25395664-25395686 AATAATGCCTTAGTGCAGAGTGG - Intergenic
1024517791 7:50274568-50274590 ACTCCTGCCTTGCTGCTGAGGGG - Intergenic
1025249304 7:57341443-57341465 CTTCCTACCTTGGTGGTGAGGGG - Intergenic
1030488629 7:110203925-110203947 GAACCTGCCTTGGGCCTGAGGGG - Intergenic
1030829436 7:114202677-114202699 AATCATGCCTTTGTGCTAAGAGG + Intronic
1032414604 7:131726352-131726374 AATCCTTCCTGTGTCCTGAGTGG + Intergenic
1032725641 7:134588040-134588062 AATATTGCCTTTGTGCTCAGGGG - Intergenic
1035603620 8:914517-914539 GATGCTGTCTTTGTGCTGAGTGG + Intergenic
1040658731 8:49544156-49544178 ACTCCAGCCTGGGTGCAGAGTGG + Intronic
1041647619 8:60269767-60269789 GATCCAGCCTTGGTGTTGACTGG + Intronic
1042355806 8:67826138-67826160 CTTCCTTCCTTGGTGCTGATGGG + Intergenic
1043403179 8:79903662-79903684 AAGCCTGTCCTGGTCCTGAGAGG + Intergenic
1043788366 8:84431338-84431360 AATCCTAACTTTGTGGTGAGTGG - Intronic
1045280592 8:100746451-100746473 AATCCTGCCTGAGGGCTCAGGGG + Intergenic
1046185339 8:110707374-110707396 AAACCTGTCTTGGTGCTTGGAGG - Intergenic
1050195146 9:3074961-3074983 AATCCTTCATGGGGGCTGAGAGG + Intergenic
1052844409 9:33322410-33322432 AAACCTGACTGGGAGCTGAGGGG - Intronic
1053484895 9:38445061-38445083 AATCCTGCCTTGGAGGTCTGAGG - Intergenic
1054971251 9:71090166-71090188 AAACCTACCTTGATGGTGAGGGG + Intronic
1055626450 9:78181528-78181550 ACGCCTGCCTTGGTCCTTAGTGG + Intergenic
1057132641 9:92664725-92664747 ACTCCTGCCTTGTTGCCAAGCGG - Intronic
1057853892 9:98587438-98587460 AATCCTTCCTTGGTGCCCAGGGG + Intronic
1058729531 9:107836635-107836657 AATCCTGCCCTGGAGGAGAGGGG - Intergenic
1059483733 9:114611604-114611626 GATCCGGGCTTGGTGCTGTGGGG + Intronic
1059650052 9:116307564-116307586 ATTCCAGCCTTGGTGATGAGAGG + Intronic
1060967207 9:127717902-127717924 AAACCAGCCTTGGAGGTGAGAGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061820462 9:133224865-133224887 AATCCAGCCCTGGGGCTCAGTGG - Intergenic
1187611269 X:20946233-20946255 AAGTCTGCACTGGTGCTGAGAGG - Intergenic
1187869800 X:23755138-23755160 AATCCTCCATTGCTGATGAGTGG + Intronic
1190748077 X:53338337-53338359 AATCCTGCCTTGGTTTTTTGGGG + Intergenic
1190798753 X:53769542-53769564 AATCCTGCCTTGGTTTTTTGGGG + Intergenic
1190876166 X:54461757-54461779 AATCCAGTCTTGGGGCTCAGTGG + Intronic
1193998276 X:88393547-88393569 AATCCTGCTGTGTTGCTTAGTGG + Intergenic
1195254906 X:103081512-103081534 CATCCTGCCTGGGTCCTCAGAGG - Intronic
1197267233 X:124387951-124387973 AATTCTGCCTTGGTCCAGGGAGG - Intronic
1198081341 X:133242713-133242735 GATTCTGTCTTGGTGTTGAGTGG - Intergenic
1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG + Intronic
1198932762 X:141878939-141878961 AGTCCTGCCTTGGGCCTGGGAGG + Intronic
1200697524 Y:6374108-6374130 TGTCCTGCATTGCTGCTGAGGGG + Intergenic
1201036589 Y:9790591-9790613 TGTCCTGCATTGCTGCTGAGGGG - Intergenic
1202052911 Y:20798948-20798970 AGTCCTCCCGTGGTGCCGAGGGG + Intergenic