ID: 1198227332

View in Genome Browser
Species Human (GRCh38)
Location X:134657511-134657533
Sequence CTGTTACTACAGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198227332_1198227337 25 Left 1198227332 X:134657511-134657533 CCCTGCTGCCTCTGTAGTAACAG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1198227337 X:134657559-134657581 GACAAGTTATTAGAGCTGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1198227332_1198227335 3 Left 1198227332 X:134657511-134657533 CCCTGCTGCCTCTGTAGTAACAG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1198227335 X:134657537-134657559 TCAGTATATTGATAGAAAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 351
1198227332_1198227336 24 Left 1198227332 X:134657511-134657533 CCCTGCTGCCTCTGTAGTAACAG 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1198227336 X:134657558-134657580 GGACAAGTTATTAGAGCTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198227332 Original CRISPR CTGTTACTACAGAGGCAGCA GGG (reversed) Intronic
900004982 1:39223-39245 CTGTTCAGAAAGAGGCAGCAGGG - Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
906043303 1:42806282-42806304 CAGTGACTTCAGAGGCAGCAGGG + Intergenic
906975586 1:50568763-50568785 CTGATACTACAGTGGTAGCAGGG + Intronic
907283497 1:53366025-53366047 CAGAGACTCCAGAGGCAGCACGG - Intergenic
907621061 1:55981144-55981166 TTGTTGCAACAGAGACAGCATGG + Intergenic
911117367 1:94259683-94259705 TAGGGACTACAGAGGCAGCATGG + Intronic
912903514 1:113678826-113678848 CTCTTTCTACAGATACAGCATGG - Intronic
919275526 1:195410639-195410661 CTTTTATTACTGAGGCAGTATGG + Intergenic
922566466 1:226604762-226604784 CTGTTGGTTCAGAGGCTGCAGGG + Exonic
923055424 1:230423146-230423168 CTGTTTTTACAGTTGCAGCAAGG + Intronic
923261590 1:232273014-232273036 TTTTTACTACAAAGGCAGAAAGG - Intergenic
1064290099 10:14025979-14026001 TTGTTACTACAGTCACAGCAAGG - Intronic
1065297818 10:24293414-24293436 CAGTGCCTGCAGAGGCAGCAAGG - Intronic
1065334077 10:24637164-24637186 CAGTTACTTTTGAGGCAGCATGG - Intronic
1065552381 10:26881861-26881883 CAGTGACAACATAGGCAGCATGG + Intergenic
1069755607 10:70772829-70772851 CTGTTTCTCCAGAGACAGGAGGG - Intronic
1069979917 10:72245266-72245288 CTGTGGCCACAGAGTCAGCAGGG - Intergenic
1070270553 10:74950406-74950428 CTGTTACTGCAGATGCAGACGGG + Intronic
1072720710 10:97779343-97779365 CTGAGACTGCAGAGGGAGCAGGG - Intergenic
1073207692 10:101777235-101777257 CTGCTCCCACAGAAGCAGCATGG - Intronic
1073942542 10:108714692-108714714 CTGTTGCTTCAGAGGGTGCAAGG - Intergenic
1073996718 10:109324187-109324209 CTTTTACTACAGATTCAGCCAGG + Intergenic
1075082812 10:119395319-119395341 CAGTGACCACAGAGGCAGCCAGG - Intronic
1078725677 11:13928835-13928857 CTGTTGCTAGAGAGGCAGCCTGG - Intergenic
1078959536 11:16248566-16248588 CTGTTGCTTCAGAGGGTGCAAGG - Intronic
1079785709 11:24669047-24669069 CTGCTACTAGGCAGGCAGCAAGG + Intronic
1079870073 11:25786348-25786370 CTGTTTCTGCAGGGCCAGCAAGG + Intergenic
1081020371 11:37940176-37940198 CAGCTCCTCCAGAGGCAGCAAGG - Intergenic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1088578627 11:111296812-111296834 CTGTTCCTTCAGAGGGGGCAAGG + Intergenic
1088905668 11:114153958-114153980 CTTTTACTACAGAGGTGGCAGGG - Intronic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1093873809 12:24325620-24325642 CTGTGTCTACAGAGGAAGAAGGG + Intergenic
1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG + Intergenic
1098448685 12:70594501-70594523 CTGTTATGACTGAGGCTGCAGGG - Exonic
1098477598 12:70922728-70922750 CTGTTACTAGAAATGCTGCAGGG + Intergenic
1099658637 12:85527452-85527474 CTGTGACGAGAGAGGCAGCCTGG - Intergenic
1103126575 12:118428112-118428134 CTTTTATTACAGTGGCAGCAGGG - Intergenic
1103165284 12:118765126-118765148 CTGTTACAACAGTGGCAGACTGG + Intergenic
1108186790 13:47895939-47895961 CAGTTCCTTCAGAGGAAGCACGG + Intergenic
1110428996 13:75401267-75401289 CTGTGACTTCAGAGGAAGAAAGG - Intronic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1114857923 14:26474081-26474103 CTGTTACTACAGAGGATACCTGG + Intronic
1117314798 14:54564505-54564527 TTGTTACTGTAGAGGCAGAAAGG - Intergenic
1118478636 14:66141951-66141973 CATTTACCACAGAGGTAGCATGG - Intergenic
1120155888 14:81092873-81092895 CAGTTCCTACAGAGGTTGCATGG - Intronic
1124012405 15:25849330-25849352 CTGTCCCTCCGGAGGCAGCAAGG + Intronic
1124639713 15:31390045-31390067 CTGTTAATAAAAAGGAAGCAAGG - Intronic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1126564146 15:50077046-50077068 CTGATACTTCATAGGCATCATGG + Intronic
1130144786 15:81265733-81265755 CTGTTACTGCAGAGAGAGTAAGG - Exonic
1132448527 15:101951721-101951743 CTGTTCAGAAAGAGGCAGCAGGG + Intergenic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1139065172 16:63304075-63304097 CTGTTATTATAGAGGCTGAAGGG + Intergenic
1139397303 16:66650441-66650463 CTGAGACTACAGATGCAGCCTGG + Intronic
1139637977 16:68270362-68270384 CTGTCACTCCTGAGGCAGCTGGG - Intronic
1140234757 16:73148175-73148197 TTGTTATGACAGAGACAGCATGG + Intergenic
1141377071 16:83541196-83541218 CTGATACTCAACAGGCAGCAGGG - Intronic
1144012045 17:11158241-11158263 CTGTCACTCCTGAGACAGCAAGG - Intergenic
1145098362 17:20051828-20051850 CTTTTATTAGAAAGGCAGCATGG + Intronic
1151732422 17:75919455-75919477 CTGCTCTTACAGAGGCAGGAGGG - Intronic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1153229885 18:2925385-2925407 CAGTTACGGAAGAGGCAGCAGGG + Intronic
1154001581 18:10486419-10486441 GTGTTATTAGAGGGGCAGCATGG - Intronic
1155879904 18:31132276-31132298 CAGTTCCTTCAGAGGGAGCACGG + Intronic
1159050113 18:63413850-63413872 CTGCTACAATAGAGGAAGCATGG - Intronic
1159148900 18:64494613-64494635 CTGATACAACAGAAGCAGAAGGG + Intergenic
1160636735 19:80832-80854 CTGTTCAGAAAGAGGCAGCAGGG - Intergenic
1163468249 19:17482109-17482131 CTAGTACCAGAGAGGCAGCAGGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
927062678 2:19439249-19439271 CTATTACTTTAGAGGAAGCAAGG - Intergenic
927467775 2:23350156-23350178 CTGTGCCTACAGTGGCAGCTTGG - Intergenic
928023180 2:27719931-27719953 TTGTCACTGCAGAGGGAGCAAGG - Intergenic
928425284 2:31172687-31172709 CTGTCACTCCAGGGGAAGCAGGG - Intergenic
930336196 2:50049386-50049408 CTTATTTTACAGAGGCAGCAAGG + Intronic
930609369 2:53524169-53524191 TTGTTGCTATGGAGGCAGCAGGG - Intergenic
931079434 2:58752811-58752833 CTGTTGCTTCAGAGGGTGCAAGG + Intergenic
932293895 2:70608552-70608574 CTGTTACTGCAGATTCAGCCAGG - Intronic
932423428 2:71614357-71614379 GTGAAACTACAGATGCAGCAAGG - Intronic
934089447 2:88538504-88538526 CTGTTACTAACTAGGCAGGAGGG - Intergenic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
935983341 2:108648593-108648615 TTGTTACTACAAAAACAGCATGG + Intronic
936564743 2:113574209-113574231 CTGTTGAGAAAGAGGCAGCAGGG + Intergenic
938049501 2:128155102-128155124 CTGTTCCTACAGAGGAAGCAGGG - Intronic
940020134 2:149147625-149147647 CAGCTACTCCAGAGGCTGCAGGG - Intronic
944891414 2:204120904-204120926 CAGTGGCTACAGAGGCAGCCAGG - Intergenic
945217305 2:207447267-207447289 CTGTAACTACAAAAGGAGCAGGG - Intergenic
947152067 2:227125798-227125820 GTGTTACTGCAGAGGCACCTTGG - Intronic
947364315 2:229378483-229378505 TGGCTACTGCAGAGGCAGCAAGG + Intronic
1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG + Intergenic
1171492636 20:25532137-25532159 CTGGGACTGCAGGGGCAGCAAGG + Intronic
1172645396 20:36465946-36465968 CTGGGACTCCAGAGCCAGCAAGG - Intronic
1174770238 20:53292695-53292717 CTGTTAGTACACATGCAGCATGG - Intronic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1183984090 22:41560092-41560114 CTGGTACTACTGAGGCAGGCTGG - Intergenic
950972313 3:17201590-17201612 GTGTTACAGCAGAGGCAGGATGG + Intronic
953253737 3:41268899-41268921 CAGCTGCTACAGAGCCAGCAAGG + Intronic
954975728 3:54692429-54692451 CTGTGCCTGCAGAGGGAGCAGGG + Intronic
955656375 3:61249436-61249458 ATCTAAGTACAGAGGCAGCATGG + Intronic
956252938 3:67253682-67253704 CTGTTGCTTCAGAGGGTGCAAGG + Intergenic
956865787 3:73367276-73367298 CTGTTACTGCAGAGCAAACAAGG + Intergenic
958908747 3:99969967-99969989 CTGTTACATCAGAGGCATTAGGG + Intronic
961871396 3:129991105-129991127 CTGATAAAACAGAGGCACCATGG + Intergenic
963868987 3:150393434-150393456 TTATAATTACAGAGGCAGCAAGG + Intergenic
964184197 3:153923209-153923231 CTGTTATATCAGAGGCAGCATGG + Intergenic
964477991 3:157113960-157113982 ATGGTACTACATAAGCAGCAGGG - Intergenic
966351419 3:179036074-179036096 CTTGGACTTCAGAGGCAGCAGGG + Intronic
968563902 4:1299308-1299330 CTGTGACAACAGAGGCATCAAGG - Intronic
968690935 4:1989826-1989848 CTGGCACTCCAGTGGCAGCATGG + Exonic
969636222 4:8370711-8370733 CTGCAACCACAGAGCCAGCATGG + Intronic
973330283 4:48905767-48905789 ATGTGATTACAGGGGCAGCACGG + Intronic
973694260 4:53474632-53474654 CTGTTACTACAGGGAGAGGATGG + Intronic
975901852 4:79162832-79162854 CTTTTCCTAAAGAGGCAACATGG + Intergenic
976353992 4:84093836-84093858 CTGTTCTTTCAGAGGCAGCTGGG - Intergenic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
979384937 4:120053701-120053723 CTGTGACTACACAGGCTGCTTGG + Intergenic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
981588879 4:146334660-146334682 TTGCAACTAAAGAGGCAGCAGGG + Intronic
983719678 4:170833953-170833975 CCTTTAATTCAGAGGCAGCAAGG + Intergenic
985041418 4:185895200-185895222 CTGTTGCTTCAGTGGCATCAGGG - Intronic
985076233 4:186217996-186218018 AAGTTGCTACAGAGGCAGCATGG - Intronic
985420120 4:189776888-189776910 CTGTGACTGCAGGTGCAGCAGGG - Intergenic
989286224 5:39703122-39703144 ATGTGACTACTTAGGCAGCAAGG + Intergenic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
994530980 5:100970923-100970945 CTGCTACTACACAGGAAGGAAGG - Intergenic
996234630 5:121110301-121110323 CTGTTGCTACTGAGGCTTCAAGG - Intergenic
996394167 5:122995892-122995914 CTCTTATAACAGGGGCAGCATGG + Intronic
998046801 5:138993617-138993639 CTGCTTCTTCAGAGCCAGCAAGG - Intronic
1002296754 5:178235638-178235660 CTGGAACTCCAGAGGCGGCATGG + Intergenic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1002830828 6:818941-818963 CTGCTACAACCCAGGCAGCAGGG - Intergenic
1003128918 6:3378434-3378456 CTGTTGCTACTGAGGCAACAGGG + Intronic
1003254671 6:4464474-4464496 CTGTGCCTTCAGAGGAAGCATGG + Intergenic
1004292417 6:14380452-14380474 CTGTTACTGGAGAGGCAGATAGG - Intergenic
1006388687 6:33746404-33746426 CTGGGACTACAGAGGAAGCTGGG - Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1006867801 6:37222868-37222890 CTGTCACTCCAGCTGCAGCAGGG - Intronic
1010177070 6:73041099-73041121 CTGTCCCTATAGAGACAGCAAGG + Intronic
1013392757 6:109703362-109703384 CTGACACTACAGAGGTATCAGGG + Intronic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1018549077 6:164973404-164973426 CAGTTATTATAGAGTCAGCATGG + Intergenic
1018608639 6:165624996-165625018 CAGTTAGTACAAAGGCACCAAGG + Intronic
1019087045 6:169488260-169488282 CTGTTGCTGGAGAGGCAGCCAGG + Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019506632 7:1394741-1394763 CTGGTACTCCACAGACAGCAAGG + Intergenic
1020676634 7:11191944-11191966 CTGGTACTAGAGAGACAGCCAGG + Intergenic
1021323734 7:19242076-19242098 CTGCTCCTGCAGAGGTAGCAGGG + Intergenic
1022446075 7:30471782-30471804 CTGTTTCTAAAGAGCCAGGAAGG + Intronic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1028765413 7:94552551-94552573 CTATTACTACAGAGAAAGGAAGG - Intronic
1034725692 7:153333210-153333232 CTGACACTACAGGGACAGCAGGG + Intergenic
1041040050 8:53837740-53837762 TTGCTCCTACTGAGGCAGCAAGG + Intronic
1042892170 8:73624682-73624704 CAGTTCATTCAGAGGCAGCATGG - Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044818535 8:96138414-96138436 CTATAACTACTGAGGAAGCAGGG - Intergenic
1047483579 8:125308008-125308030 CTGTTTCCACAGGGGAAGCAGGG - Intronic
1047824659 8:128560141-128560163 CTTGTACTAAAGAGGCCGCAGGG - Intergenic
1049887678 9:39005-39027 CTGTTCAGAAAGAGGCAGCAGGG - Intergenic
1053463102 9:38285727-38285749 CAGTTACTCCAGAGGCTGAAAGG - Intergenic
1056204143 9:84304177-84304199 TTGTTACTACAGTGGCAGAATGG + Intronic
1058363189 9:104175112-104175134 CTAGTACTACAGAGGCCACAAGG + Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1061527437 9:131178440-131178462 CCGCTACTACAGAAGCAGCCAGG - Intronic
1061593414 9:131613463-131613485 CTCTGACTGCAGAGGCAGGAAGG + Intronic
1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG + Intronic
1185947601 X:4395171-4395193 AAGTTACTACAAAGTCAGCAGGG + Intergenic
1186615108 X:11177963-11177985 CTCTTCCTACAGAGACAGCTAGG + Intronic
1188805637 X:34585240-34585262 CTGTTACTTCACAGACAGCAAGG - Intergenic
1190775095 X:53546289-53546311 GTGTTACGACAGAGGGAGCATGG + Intronic
1191673357 X:63769726-63769748 CTGTTGCTTCAGAGGGTGCAAGG + Intronic
1192993544 X:76488145-76488167 TTGAGTCTACAGAGGCAGCATGG + Intergenic
1193314986 X:80054750-80054772 CTGTTCCAATAGAGGTAGCAAGG + Intergenic
1193453306 X:81698316-81698338 ATGTTAGTAAAGAGGCAGAATGG + Intergenic
1197411305 X:126119550-126119572 CTGTTACTTCAGAGAGTGCAAGG + Intergenic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1201233187 Y:11885617-11885639 ATGTTACTACGGAGGCTGGATGG + Intergenic
1201282776 Y:12355635-12355657 CTGTAACTCGAAAGGCAGCATGG - Intergenic
1201755319 Y:17480756-17480778 CCGTTTCTCCACAGGCAGCAGGG + Intergenic
1201846233 Y:18425229-18425251 CCGTTTCTCCACAGGCAGCAGGG - Intergenic
1201917195 Y:19195155-19195177 CTGTTGCTACAGAGACTGCATGG + Intergenic