ID: 1198229371

View in Genome Browser
Species Human (GRCh38)
Location X:134674805-134674827
Sequence CTGTAAAGACAGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 2, 3: 74, 4: 661}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198229371_1198229377 18 Left 1198229371 X:134674805-134674827 CCTTCCTCTTCCTGTCTTTACAG 0: 1
1: 0
2: 2
3: 74
4: 661
Right 1198229377 X:134674846-134674868 CCCAATCTTTCAGCAGAACAGGG 0: 1
1: 0
2: 2
3: 10
4: 112
1198229371_1198229375 17 Left 1198229371 X:134674805-134674827 CCTTCCTCTTCCTGTCTTTACAG 0: 1
1: 0
2: 2
3: 74
4: 661
Right 1198229375 X:134674845-134674867 ACCCAATCTTTCAGCAGAACAGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198229371 Original CRISPR CTGTAAAGACAGGAAGAGGA AGG (reversed) Intronic
900458335 1:2787934-2787956 CGGTATAGACAGGCAGAGGCAGG + Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900842231 1:5062124-5062146 CTACAGAGACAGGAAGATGAGGG + Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903912974 1:26741983-26742005 CTGAAAAGATAGGAATTGGAAGG + Intronic
904565804 1:31427685-31427707 CTGCAAAGTGAGGATGAGGATGG - Intronic
904640435 1:31923203-31923225 CTGAAAAGAAAAGAAGAGGCTGG - Intronic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
904907842 1:33911591-33911613 CTCTAAGGACATGAAAAGGAGGG + Intronic
904920374 1:34003252-34003274 CTGTAAAGACCTCAAGGGGAAGG - Intronic
905463583 1:38136779-38136801 CTATAAAGACAGGAACAGCAAGG + Intergenic
905474954 1:38219504-38219526 ATGTGCAGGCAGGAAGAGGAAGG + Intergenic
906970337 1:50506913-50506935 CAGTAATGGCAGGAAGAAGAAGG - Intronic
907560606 1:55384138-55384160 CTGTAAACACCTGAAGAGAATGG + Intergenic
908090928 1:60685169-60685191 CTCAAAAGACAGGAAGATGTGGG + Intergenic
908469508 1:64429940-64429962 CAGAAAAGCAAGGAAGAGGAAGG - Intergenic
910053024 1:82998628-82998650 TTGCAAAGAAAGGAAGAGGAGGG + Intergenic
910437495 1:87220073-87220095 AAGTGAAGACAGGAAGTGGAGGG + Intergenic
910638399 1:89434521-89434543 TGGTAAAGAGAGGAAGAGGCAGG - Intergenic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
911235041 1:95403424-95403446 CTCAAAAGACAGGAAGATGAGGG + Intergenic
911379476 1:97094434-97094456 ATGTAAAGAATGTAAGAGGAGGG + Intronic
911512671 1:98826891-98826913 CTGAGAAGATAGGAAGATGATGG + Intergenic
911786115 1:101950265-101950287 ATGTGAAGAAAGCAAGAGGATGG - Intronic
912303103 1:108536805-108536827 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
912357319 1:109065523-109065545 CTTTAAATACTGGAAAAGGAGGG + Intronic
912714202 1:111970800-111970822 CTGCAAAGAGAGAAAGAGGTGGG - Intronic
913075264 1:115336677-115336699 CTGTAAACACAGGATAAGAAGGG + Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913340058 1:117749814-117749836 CTAAACAGACATGAAGAGGAAGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
916461998 1:165034821-165034843 CTATCAAGACAGGCAGAGGAGGG + Intergenic
916584258 1:166136538-166136560 TTGTAAAGAGGGGAAGAGGAAGG - Intronic
916832656 1:168508949-168508971 CAGGAAGGAGAGGAAGAGGATGG - Intergenic
916962012 1:169898036-169898058 GTCAAAAGACAGGAAGAGGCAGG - Intergenic
917686544 1:177422307-177422329 CTGTCAAGAAATGAAAAGGAAGG + Intergenic
918152724 1:181812144-181812166 TGGAAAAGAGAGGAAGAGGAAGG + Intergenic
918791479 1:188836193-188836215 CTGTATAGATAGGAAGAAGAAGG + Intergenic
919707771 1:200695005-200695027 CTTTAAAGACCGGCAGAGAAAGG + Intergenic
921880415 1:220249210-220249232 CTCAGAAGACAGGAAGAGGTGGG + Intronic
921906310 1:220498797-220498819 CTGGAAAGACAGGCAGAGAAAGG - Intergenic
921913260 1:220576012-220576034 CTGAAAAGAAAGGATGAGGGAGG - Intronic
922042648 1:221911858-221911880 CTGTGAAGACAGGAAGATGGGGG + Intergenic
922469631 1:225867973-225867995 CTGGAAGGACAGGTAGTGGATGG + Exonic
922480483 1:225937287-225937309 CGGGAAAGACAGGAAATGGAAGG + Exonic
922576870 1:226666671-226666693 CTGGAGAGATAGGAAGAGCAAGG - Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922675888 1:227549008-227549030 CAGTAAAGAAAGGAAAATGAAGG + Intergenic
924032459 1:239900153-239900175 CTGTTGAGTCAGGATGAGGAAGG + Intronic
924365990 1:243294531-243294553 CTGAAAAGACTGGGAGAGGTGGG - Intronic
924594578 1:245434410-245434432 CTGCAGAGACAGGGAGAGAAAGG - Intronic
1063140051 10:3248057-3248079 CTGTAAAAATAAGAAGAGGCCGG + Intergenic
1063222651 10:3984972-3984994 CTGGGAAGAGGGGAAGAGGAGGG + Intergenic
1063558897 10:7107956-7107978 ATGTAAAGAGAGAAAGAGAAAGG - Intergenic
1063616820 10:7607477-7607499 CTCTACAGAAAGAAAGAGGAGGG + Intronic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064250810 10:13705086-13705108 CTGAGAAGACAGGCAGAAGAAGG - Intronic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1065066367 10:21969304-21969326 CTGTGAAGAGAGGATGAGGGCGG + Intronic
1065095593 10:22277825-22277847 CTGTAGAGAAAGGGAGAGAATGG + Intergenic
1065565542 10:27004164-27004186 CTAGAAAGACAGGAGGAGAAGGG + Intronic
1065643789 10:27813811-27813833 CTGTAGAGAAAAGAGGAGGAAGG + Intronic
1065852270 10:29800719-29800741 AGGAAAAGACAGGAAGATGAGGG - Intergenic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1067081216 10:43213486-43213508 CTTTTAAGAAAGTAAGAGGAGGG + Intronic
1068042637 10:51845242-51845264 CTGGAAAGACAGCAAGAAGAGGG - Intronic
1068222146 10:54058069-54058091 CTCAAAAGGCAGGAAGATGAGGG - Intronic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1069929134 10:71870432-71870454 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
1070665375 10:78338910-78338932 CTCTGGAGACAGGCAGAGGAAGG - Intergenic
1070981992 10:80656791-80656813 GGGTGACGACAGGAAGAGGAGGG - Intergenic
1071087447 10:81879054-81879076 CTTTAAAGGCAGGAGGAGAAAGG + Intronic
1071320303 10:84448530-84448552 TTGTTAAGAAAGGAATAGGAAGG + Intronic
1071338237 10:84619429-84619451 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1071368766 10:84928715-84928737 CTGAGAAGGCAGGAAGGGGAAGG + Intergenic
1071990239 10:91094180-91094202 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1071998790 10:91173913-91173935 TTCTAAAGACAGGCAAAGGAAGG - Intronic
1072027696 10:91477515-91477537 CTGTAAGCAGAGGAAGAGAAAGG + Intronic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1073071753 10:100798761-100798783 CTGTCCAGACTGGGAGAGGAGGG - Intronic
1073513883 10:104060338-104060360 GAGAAAAGACAAGAAGAGGAAGG + Intronic
1074225870 10:111483801-111483823 CAGCACAGAAAGGAAGAGGAAGG - Intergenic
1074287884 10:112115597-112115619 CTGGGAAGAGAGGGAGAGGAAGG + Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074375628 10:112938814-112938836 CTGAAGGGACAGGGAGAGGAGGG + Intergenic
1074510904 10:114110958-114110980 CTGTAAAGCCAGGAAAAGGCTGG + Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1074820483 10:117174686-117174708 CTGTAAAGCCTGGCAGAGGAGGG + Intergenic
1074845241 10:117391846-117391868 CTGTTTATACAGGAACAGGATGG + Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075614594 10:123882291-123882313 CTGTAAAGGCCAGAGGAGGAAGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076542688 10:131224122-131224144 CTGGAAAGAGAGGGAGAGGATGG - Intronic
1076695453 10:132245188-132245210 CTGTACAGCCAGGAGCAGGAGGG + Intronic
1076704156 10:132292128-132292150 CTCTAAAGTCAAGAAGAGCAAGG + Intronic
1078174110 11:8955880-8955902 CTGGAAAGGCAAGGAGAGGAGGG + Intronic
1078321610 11:10339941-10339963 CTGCCAAGCCAGGAACAGGAGGG - Intronic
1078388216 11:10911839-10911861 GTGTAAAGACAGAAACAGAAAGG + Intergenic
1079475052 11:20821267-20821289 TTCTAGAGACAGGTAGAGGAAGG - Intronic
1080121016 11:28677472-28677494 TTGTAAAGACTGTAAGAGAATGG - Intergenic
1080256142 11:30292654-30292676 CTGTCAGGACCAGAAGAGGATGG - Intergenic
1081352522 11:42071524-42071546 CTGTGAAGACAGGAAGGAGTAGG - Intergenic
1081483312 11:43508277-43508299 CTTTAAACACAGGAAGGGGAGGG + Intergenic
1082045517 11:47722985-47723007 CTGAAAAGACAAAAAAAGGAAGG - Exonic
1082960683 11:58916131-58916153 CAAAAAAGACTGGAAGAGGAAGG - Intronic
1083103462 11:60334377-60334399 CTGTAATGACTGGAGGAGGTTGG + Intergenic
1083807354 11:65082756-65082778 CTTTAAAGACAAGTAGAGGCCGG - Intronic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1084401641 11:68947308-68947330 CTGCAAACACAGGCAGAGGCTGG + Intergenic
1084580418 11:70019876-70019898 CGGTGAAGCCAGGAAGATGACGG - Intergenic
1084746762 11:71175411-71175433 CTGTAAAGAGAGCAGGAGGAAGG + Intronic
1085240895 11:75054249-75054271 CTGAAAAGTCAGGAGTAGGATGG - Intergenic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1086042602 11:82496882-82496904 CAGCAAGGACAGGAAGAGCATGG - Intergenic
1086079387 11:82887737-82887759 CTATACAGAAAGGAAGGGGAAGG - Intronic
1086482794 11:87261224-87261246 CTGAGAAGAAAGGAAGAGGGAGG - Intronic
1086678337 11:89637394-89637416 CTGTCAAGAAAGGAAGGGAAAGG - Intergenic
1086954763 11:92924668-92924690 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1087126385 11:94630366-94630388 CTGAGAAGGAAGGAAGAGGAGGG + Intergenic
1087141580 11:94769535-94769557 CAGTAAAGATAGGAAGAGTAGGG - Intronic
1087142261 11:94776342-94776364 CTGTAGAGACATGCAAAGGAAGG - Intronic
1088189024 11:107206375-107206397 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1088229967 11:107663530-107663552 CTGTAAATATAGGAGAAGGAGGG - Intronic
1088724875 11:112625322-112625344 CTATCATGAAAGGAAGAGGAAGG - Intergenic
1088725010 11:112626708-112626730 CTATCATGAAAGGAAGAGGAAGG + Intergenic
1088838909 11:113605800-113605822 CATTAAAGACAGGAATAAGAAGG - Intergenic
1088938999 11:114434973-114434995 CAGAAAAGACAGGAAGATGAGGG - Intronic
1088974018 11:114798815-114798837 CAGTCAAGACAGGAAGATCAAGG - Intergenic
1089760346 11:120718255-120718277 GGGTAAAGACGGGGAGAGGAGGG - Intronic
1089891484 11:121885927-121885949 CAGTAAAGGCAGGTAGAGGCAGG + Intergenic
1090785632 11:130044868-130044890 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1091183426 11:133627676-133627698 GGGTAGAGACAGGAAGAGAAGGG - Intergenic
1091381702 12:66391-66413 CAGAAAAGAAAGGAAGAGAAGGG - Intergenic
1091394386 12:144570-144592 CTGTGCGGAAAGGAAGAGGAGGG + Intronic
1091837935 12:3599041-3599063 CTTGAAAAACTGGAAGAGGAGGG + Intergenic
1092662140 12:10750018-10750040 CTGTAAAATGAGGAAGAGAATGG + Intergenic
1092931479 12:13319912-13319934 ATGGAAAGAAAGGAGGAGGAAGG + Intergenic
1092991829 12:13910521-13910543 TGGCAAAGAGAGGAAGAGGAAGG - Intronic
1093052823 12:14522466-14522488 TTCAAAAGACATGAAGAGGAGGG + Intronic
1093089646 12:14906721-14906743 CTGTAAAGAAAATTAGAGGAGGG - Intergenic
1094390103 12:29939854-29939876 GTTTCAACACAGGAAGAGGAGGG + Intergenic
1095146268 12:38731417-38731439 TTTTAAAGACAGGATGTGGAGGG + Intronic
1095432645 12:42150496-42150518 CTGTATAGAAAGGAATATGAGGG - Intergenic
1095727969 12:45473272-45473294 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1095971778 12:47906509-47906531 CTGTAATGAAAGTAATAGGAAGG + Intronic
1096153644 12:49330166-49330188 CTGTTGAGACAGGAAGTAGAGGG + Exonic
1096778337 12:53977302-53977324 ATACAAAGACAGAAAGAGGAGGG - Exonic
1096880633 12:54666200-54666222 CTGTAAACACAAAAAGGGGAGGG - Intergenic
1097086680 12:56473940-56473962 CTGTAAATAGAGGTAGAGGGGGG + Exonic
1097501634 12:60410762-60410784 CTCATAAGACAGGAAGATGAGGG - Intergenic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1098254416 12:68602088-68602110 CTTAAAGGACAGGAAGAGGAAGG + Intergenic
1098319745 12:69231375-69231397 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1098507251 12:71267496-71267518 GTTTAAAGAGAGAAAGAGGAGGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098594373 12:72254906-72254928 CTGTAAAGAGTGGTAGAGAATGG - Intronic
1098986924 12:77022605-77022627 GTTTTAAGAGAGGAAGAGGAAGG + Exonic
1099016948 12:77354689-77354711 CTCTAAAGACACAAAGAGAAAGG - Intergenic
1099658604 12:85526889-85526911 CAAAAAAGACAGGAAGATGAGGG + Intergenic
1099795283 12:87392699-87392721 CTGAAAAAAAAGGAAGAAGAAGG + Intergenic
1100245015 12:92748922-92748944 GTGTGTAGACAAGAAGAGGATGG - Intronic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101456086 12:104832235-104832257 CCGTAAAGACAGGAATGGAAAGG - Intronic
1101788001 12:107903055-107903077 CTATAAAGACAAGAGGAGGCGGG - Intergenic
1101877774 12:108606979-108607001 ATGTAAAGCAAGGAAGTGGAGGG - Intergenic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102387010 12:112518624-112518646 CTCTAAAGACAGGAATTAGATGG - Intergenic
1102587999 12:113936595-113936617 CTGCAAAGACAGGAAAGGAAGGG - Intronic
1102649991 12:114434240-114434262 CTCTAAGAAGAGGAAGAGGAAGG + Intergenic
1102726443 12:115069702-115069724 TTGAAAAGGCAGGAAAAGGAGGG - Intergenic
1103033602 12:117638677-117638699 CTGTGAGGAAAGGAAGGGGAAGG + Intronic
1104147714 12:126051612-126051634 CAGTAAAGACAGGAAGGAGGTGG + Intergenic
1104300556 12:127560907-127560929 GTGTAAACACAGGGAGAGGCAGG + Intergenic
1104384289 12:128336801-128336823 TGGAAAAGACAGGAAGAAGATGG - Intronic
1105257766 13:18755883-18755905 CTTCAAAGACAGGGAGATGAGGG - Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106273391 13:28176973-28176995 CTGAAAAACCAGGAAGAAGAAGG + Intronic
1106835155 13:33626200-33626222 CTTCAAAGACAGGAGGAGAAAGG + Intergenic
1107308864 13:39054243-39054265 CTGTAACGACTGGAAGAGCTGGG + Intergenic
1107723365 13:43273097-43273119 TTGTAAACACAGGAAGTGAAGGG - Intronic
1107761812 13:43687722-43687744 CTGTAAATTCTGCAAGAGGAAGG - Intronic
1107821863 13:44293214-44293236 GTGGAAAGAGAGGCAGAGGAAGG + Intergenic
1108301797 13:49085025-49085047 CTGTAATGGCAGGAAGAAGCAGG - Intronic
1109157692 13:58931105-58931127 GTGAAGAGACAGGAAGAAGATGG + Intergenic
1109476258 13:62883254-62883276 CTTAAAAGACAGGAAGATGTGGG - Intergenic
1110583896 13:77164944-77164966 CTTTTAATACATGAAGAGGATGG - Intronic
1111323215 13:86657713-86657735 CAGTAAAGACAGAAAAGGGAGGG - Intergenic
1111764366 13:92509241-92509263 CAGAAAAGATAGGGAGAGGAGGG - Intronic
1112204365 13:97309472-97309494 GTGAAGAGACAGGAAGAAGATGG + Intronic
1113209469 13:107958537-107958559 CAGTAAAGAAGGGCAGAGGAGGG - Intergenic
1113532823 13:111041806-111041828 CTGAGAAGTGAGGAAGAGGAGGG - Intergenic
1113562106 13:111289736-111289758 CTGTGAAGATAGGATGAGCAGGG + Intronic
1114266891 14:21077966-21077988 CTGTAAAGTCAGGATAAGAAAGG - Intronic
1114633949 14:24177118-24177140 CTGTCCAGAGAGGAAGAGCAAGG - Intronic
1114665723 14:24376271-24376293 CTGGGAAGACAGGAAGTGGGAGG - Intronic
1115010512 14:28539692-28539714 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1115156794 14:30350027-30350049 CTATAAAGAAAGGAGCAGGATGG - Intergenic
1115324349 14:32121772-32121794 CTGTAAAGGCAGAAAGTTGATGG - Intronic
1116767389 14:49089318-49089340 CTGTAAAAAAAGGAATAGTATGG - Intergenic
1116974208 14:51097373-51097395 CTGTAATTACAAGAAGAGGTAGG + Intergenic
1117169552 14:53079237-53079259 CTCTAAAAAATGGAAGAGGAAGG - Intronic
1117813935 14:59577820-59577842 CTGTAGAGAAAAGAAGAGGAGGG - Intergenic
1117946723 14:61033996-61034018 CTGTAAAATCAGCAAAAGGAAGG - Intronic
1118024547 14:61755680-61755702 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1118793949 14:69122625-69122647 CTGGAAAGACAGGAACAGGGTGG - Intronic
1119176975 14:72575522-72575544 CAGCAAGGACAGGAAAAGGATGG + Intergenic
1119855453 14:77897088-77897110 CTGGAAAGATGGGAAGGGGAAGG + Intronic
1120515380 14:85464193-85464215 AGGGAAAGACAGGAAGATGAGGG + Intergenic
1120990931 14:90376792-90376814 CTGTAAAAAGAGGAGCAGGAAGG - Intergenic
1121022451 14:90588704-90588726 CTGTAAAGAAAGTCAGAGAAAGG - Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121433224 14:93902105-93902127 ATGTCAAGAAGGGAAGAGGAGGG - Intergenic
1122412446 14:101532686-101532708 CTGTGAAGACAGGCAGAGACTGG + Intergenic
1122612358 14:102994241-102994263 CTGAGAAGACAGGCCGAGGAGGG + Intronic
1122969791 14:105147889-105147911 CTGTAAGGAGAGGAGGAGGAGGG + Intronic
1123184615 14:106504977-106504999 CTCGAAAGTCAGGAAGACGACGG - Intergenic
1124004521 15:25785336-25785358 CTGTAAGGACAGGGAGAACATGG + Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125461305 15:39909227-39909249 CTGTAAGGTCAGGGAGATGATGG + Intronic
1125589015 15:40843477-40843499 CTGTACATACAAGATGAGGAGGG + Intergenic
1126034041 15:44530969-44530991 CTGGCCAGACAGGAATAGGAAGG + Intergenic
1126351763 15:47751556-47751578 CTGTAACTAAAGGAAGAAGAGGG - Intronic
1126374011 15:47976211-47976233 CTCAGAAGACTGGAAGAGGAGGG + Intergenic
1126799281 15:52285492-52285514 GTGGAAAGAGAGGGAGAGGACGG - Intronic
1126852238 15:52804509-52804531 TTTTAAAGACAGGAACAGGATGG + Intergenic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1126942180 15:53779394-53779416 CTCAAAAGACAGGAAGATGTGGG - Intergenic
1127259642 15:57318856-57318878 CTGTGAAGGAAGGAAGAGGGAGG + Intergenic
1127375018 15:58376413-58376435 TTGTAAAGACAGAAAGAAGGTGG + Intronic
1127407968 15:58672825-58672847 CTGAAAAAAAAAGAAGAGGAAGG + Intronic
1127573250 15:60264742-60264764 CTGTAAGGAGAGGCAGAGGGAGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130226001 15:82058842-82058864 GAGTAGAGAAAGGAAGAGGAGGG - Intergenic
1130334840 15:82949967-82949989 CTGAAAAGATGGGAGGAGGAAGG + Intronic
1130448952 15:84031415-84031437 CTGTGATGACAGAAAGAGGTAGG + Exonic
1131261819 15:90891557-90891579 CTGTACCGACTGGAAGGGGAAGG + Exonic
1131559668 15:93428541-93428563 CTTTAAAGATAGGAAGAAAAAGG + Intergenic
1131935118 15:97495459-97495481 GTGTAAAATCAGGGAGAGGAAGG - Intergenic
1132300934 15:100774983-100775005 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
1134784078 16:16925104-16925126 CTGTAAAGGAAGGTAGAAGAAGG - Intergenic
1135750817 16:25057531-25057553 CTGTAAGGGGAGTAAGAGGACGG + Intergenic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1137362746 16:47834308-47834330 CTATAAAGACTGGGAGAGGTAGG + Intergenic
1138625082 16:58245037-58245059 CTGTAAGGAAAGGCATAGGAGGG - Intronic
1138634163 16:58323616-58323638 CTGTCAAGAAAGGAAGGTGATGG - Intronic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139077115 16:63464807-63464829 CTTTAAGGACAAGAAAAGGAAGG - Intergenic
1140288100 16:73623463-73623485 CTTTAAAGACAGGTAAATGAGGG + Intergenic
1140309835 16:73838670-73838692 CTGTACAGAAAGGAAGCAGAAGG + Intergenic
1140349706 16:74250737-74250759 CTTTGAAAACAGGAAGAGGCAGG + Intergenic
1141057709 16:80833933-80833955 CTTTTAAGAGAGGAAGAGCATGG - Intergenic
1141849235 16:86633011-86633033 CCGTAGAGACAGGAAGCAGATGG - Intergenic
1142250087 16:88987501-88987523 CTGAAAAGACACGAAGGGGCCGG - Intergenic
1142682099 17:1556088-1556110 CTGTTAAGTCAGGATGGGGATGG + Intronic
1142936091 17:3332724-3332746 CAGTAAAGACAGGCATAAGAGGG - Intergenic
1143295636 17:5869878-5869900 AGGTCAAGGCAGGAAGAGGAAGG - Intronic
1143303197 17:5926332-5926354 AGGTAAAGAAAGGAAGAGGCCGG - Intronic
1143614927 17:8044062-8044084 CTGTAAAGAGAGAAAGAGGTGGG + Intronic
1143669315 17:8385492-8385514 GTGGGAAGACAGGAAGACGATGG - Intergenic
1144212267 17:13025653-13025675 CTGGAAAGAGAGGGAGAGGATGG - Intergenic
1145214005 17:21038832-21038854 CTGTAAAGATAGGAACTGGCAGG - Intronic
1146535331 17:33645945-33645967 CTTTATAGACAGGAAGATGGAGG + Intronic
1147036565 17:37685981-37686003 CTGTAAGGGAAGGAAAAGGAGGG + Intergenic
1147563752 17:41524269-41524291 CTGCAGAGAGAGGAAGAAGAGGG + Intronic
1147767563 17:42846741-42846763 CTGTGATGACAGGAATGGGATGG - Intronic
1148638737 17:49169128-49169150 CTGTAGGGAAAGGAAGGGGAAGG - Intronic
1149946631 17:60934860-60934882 ATGTAAAAACAGTAAGAGGCTGG + Intronic
1150532736 17:66001809-66001831 CTGTAATGAAAGGAAAATGATGG - Intronic
1151632183 17:75318603-75318625 TTGGAAAGACAGGAAGACCAAGG - Exonic
1152382066 17:79947229-79947251 GAGTGCAGACAGGAAGAGGAGGG - Intronic
1152848414 17:82616646-82616668 CTGTGAAGACAAGAAAAGAAAGG + Intronic
1153054754 18:934895-934917 CTGAATGGACAGGAAGAGTAGGG - Intergenic
1153769494 18:8403757-8403779 CTATAAAGACTGGAAGCTGAAGG - Intronic
1154213857 18:12401174-12401196 CTGTAATGCCAGGCCGAGGAGGG + Intergenic
1154425597 18:14269604-14269626 CTTCAAAGACAGGGAGATGAGGG + Intergenic
1154428332 18:14289189-14289211 CTTCAAAGACAGGGAGATGAGGG + Intergenic
1154433290 18:14324845-14324867 CTTCAAAGACAGGGAGATGAGGG + Intergenic
1155821258 18:30380766-30380788 CTCAAAAGACAGGAAGATGTGGG - Intergenic
1155961549 18:31999662-31999684 AAGAAAAGACAGGAAGAGGCCGG - Intergenic
1156149799 18:34227348-34227370 AAGAAAAGAGAGGAAGAGGAAGG + Intergenic
1156507603 18:37608256-37608278 CTGTAAACACAGGCAGAGCCAGG + Intergenic
1156617415 18:38803835-38803857 ATGAAAAGATAGGGAGAGGATGG - Intergenic
1156671770 18:39479375-39479397 CTTTCAAAACAGGAAGAGCAAGG - Intergenic
1156696132 18:39770484-39770506 TTTAAAAGACAGGAAGAGAAGGG - Intergenic
1157910806 18:51615750-51615772 CTGTAGAGATAGGAAGTGGAGGG - Intergenic
1158299328 18:56034017-56034039 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1159125128 18:64214892-64214914 CTGAATTGACAGGTAGAGGAAGG + Intergenic
1159360959 18:67402041-67402063 CTGTATAGACAGGATTAGAAGGG + Intergenic
1160258344 18:77266356-77266378 CTGAGAAGACAGGAAGATGTGGG - Intronic
1160829392 19:1095976-1095998 TTGCAAAGACAGGAAGAGTCTGG - Intergenic
1161137965 19:2631694-2631716 TTATAAAAACAGGAAGTGGAGGG + Intronic
1161230079 19:3170133-3170155 CTCTAAAGACAAAAAGAGGCTGG - Intergenic
1162593362 19:11607763-11607785 CTCAAAAGACAGGAAGATGTGGG - Intronic
1163718378 19:18885813-18885835 TGTTAAAGACAGGAAGAGGCCGG - Intronic
1163775619 19:19215586-19215608 GTGTGAAGTCAGGAGGAGGATGG + Intronic
1164449173 19:28345167-28345189 GTGTAAGCACAGGAAGTGGAAGG + Intergenic
1164765138 19:30758926-30758948 CTCTCAAGAGAGGAAGGGGATGG - Intergenic
1164926077 19:32131025-32131047 ACGTAAAGACAGAAAGGGGATGG + Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1166024304 19:40066513-40066535 CTGTGAAGACAAGAAGAGAGTGG + Intergenic
1166332450 19:42086800-42086822 CAGGAAAGAGAGGAAGGGGAGGG + Intronic
1166832578 19:45647561-45647583 GTGGAAAGAGAGGGAGAGGAGGG - Intergenic
1167701169 19:51046949-51046971 GGGCAAAAACAGGAAGAGGAGGG + Intergenic
1167969925 19:53182913-53182935 CTGGAAGAAGAGGAAGAGGAAGG - Exonic
1168397364 19:56059995-56060017 AGGTGAAGACAGGATGAGGAAGG + Intronic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
1168667472 19:58215255-58215277 CTTGCAAGACAGGAAGAGGAAGG + Intergenic
925213954 2:2076248-2076270 CAGGAAAGACAGGAAAAGAAAGG + Intronic
925234177 2:2263586-2263608 CTGTAAGTAAAGGCAGAGGAGGG - Intronic
925260783 2:2526693-2526715 TTGCAAAGGCAGGAACAGGAAGG - Intergenic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
925560110 2:5182507-5182529 CTGAGAAGACAGGAAGATGTGGG + Intergenic
925654105 2:6126303-6126325 CTGGAGAGCCAGGAAGTGGATGG + Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927598043 2:24414745-24414767 CTTTAAAGATAAGGAGAGGATGG - Intergenic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
927845858 2:26472666-26472688 ATGGACAGACAGGCAGAGGAAGG + Intronic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
928235595 2:29536687-29536709 CTCACAAGACAGGAAGACGAGGG + Intronic
928246648 2:29635439-29635461 ATGTAAAGACAGGCAGAGATTGG + Intronic
928486312 2:31735893-31735915 TTCTCAAGACAGGAAAAGGAGGG - Intergenic
929214828 2:39401200-39401222 CTATACAGACAGGAAGGGGAGGG + Intronic
929325938 2:40610726-40610748 CTCAGAAGACAGGAAGATGAGGG - Intronic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930471816 2:51825819-51825841 CTAAAGAGAAAGGAAGAGGAAGG + Intergenic
931093606 2:58914829-58914851 CTGTAAAGACAGAAAGCTTAGGG + Intergenic
931436304 2:62250296-62250318 TTGTAGAGACAGGAAGGGCAGGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932697436 2:73968535-73968557 ATGTAAACACAAGCAGAGGAGGG - Intergenic
933230926 2:79806472-79806494 CTGGGAAGAAAGGGAGAGGAAGG + Intronic
933420400 2:82038290-82038312 CTCAGAAGACAGGAAGATGAGGG - Intergenic
933639994 2:84748642-84748664 CTCAGAAGACAGGAAGATGAGGG - Intronic
935931761 2:108134182-108134204 CTCAGAAGACAGGAAGATGAGGG - Intergenic
937666138 2:124489342-124489364 ATGTGAAGACAGGGAGAAGAGGG - Intronic
937742020 2:125366288-125366310 TTGTAAAGAGAGTAAGAGAAAGG + Intergenic
938089916 2:128424751-128424773 CTGTCAAGTCAGGAGGGGGATGG - Intergenic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939238363 2:139526674-139526696 CTAAAAAGGCAAGAAGAGGAAGG + Intergenic
939241854 2:139571839-139571861 CTCTGAAAACAGGAAGATGAAGG + Intergenic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
939580744 2:143942575-143942597 GGGTAAGGAAAGGAAGAGGAAGG - Exonic
939698585 2:145359999-145360021 AGGTAAAGCAAGGAAGAGGAAGG + Intergenic
940156386 2:150661245-150661267 CTCAGAAGACAGGAAGATGAGGG + Intergenic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
940982973 2:160023949-160023971 CTGTAAGGAAAGGAAGAGCAAGG + Intronic
941316812 2:164003767-164003789 CATTAAAGAAAGGAAGAGGAAGG - Intergenic
942191728 2:173477429-173477451 CTGTAAGGACAGGGAGAGAGTGG + Intergenic
942738184 2:179140416-179140438 ATGTGAAGACAGGCAGAAGATGG + Intronic
942758071 2:179365184-179365206 ATGTAAAGGCAGGAAGAAAATGG + Intergenic
944045758 2:195410053-195410075 TTGCAAAGACAGGAAGGGGGTGG - Intergenic
944480496 2:200152796-200152818 CTGTAAAGAGAGAAAGAGCTTGG - Intergenic
944756041 2:202762770-202762792 GGGTAATGACAGGAAGAAGAAGG + Intronic
945221140 2:207485481-207485503 CTGGAAAGGAAGGTAGAGGAAGG + Intergenic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
946009079 2:216550298-216550320 CTGGAAAGCCAGGCAGAGGCAGG - Intronic
946113744 2:217443899-217443921 CTGTCAAGTCATGAAGAGGCTGG - Intronic
946153649 2:217792860-217792882 CTGTAAAGTCTGCAAGAGCAAGG - Intergenic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
946774341 2:223122139-223122161 CTCTAAAAAAAAGAAGAGGAAGG - Intronic
946980844 2:225213417-225213439 ATGTAAAGACAGGGGGATGATGG - Intergenic
947443073 2:230140328-230140350 CTCAGAAGACAGGAAGATGAGGG + Intergenic
947620775 2:231589510-231589532 CTTTATAGACAGGAAGAGGGTGG + Intergenic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
1168911347 20:1449733-1449755 CTGTAAAGATAGGAGGAGTTGGG - Intronic
1169357493 20:4919770-4919792 CTGGAAAGAATGGGAGAGGACGG - Intronic
1169393359 20:5208185-5208207 TAGTAAAGAAAGGAAAAGGAAGG - Intergenic
1170412914 20:16109673-16109695 TTGGAAAGAAAGAAAGAGGAGGG - Intergenic
1170908002 20:20533935-20533957 TTGTAAAGAAAGTAAAAGGAAGG + Intronic
1170968594 20:21098990-21099012 GTGTAGAGACAAGAAGAGCAAGG + Intergenic
1171442460 20:25176382-25176404 GTGTGAAGCCAGGAAGAGGAGGG + Intergenic
1171727642 20:28640189-28640211 CTGAAAAGTCAGGAAAAGAAGGG - Intergenic
1171941126 20:31330936-31330958 CTCTAAGGAAAGGAAGAAGAAGG + Intergenic
1173162194 20:40661301-40661323 CTGCAGAGACAGGAACAGGCAGG + Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1174473363 20:50777939-50777961 CTGTCAAGAAAGAAAGAGAAAGG - Intergenic
1174872602 20:54197135-54197157 CTGCGAAGACATGAGGAGGAGGG - Intergenic
1175715109 20:61250289-61250311 CTATACAGTCAGGCAGAGGAGGG - Intergenic
1176283504 20:64328442-64328464 CAGAAAAGAAAGGAAGAGAAGGG + Intergenic
1176314170 21:5226498-5226520 CTGAAAAGTCAGGAAAAGAAGGG - Intergenic
1176843758 21:13860912-13860934 CTTCAAAGACAGGGAGATGAGGG - Intergenic
1176846434 21:13880232-13880254 CTTCAAAGACAGGGAGATGAGGG - Intergenic
1177325474 21:19582826-19582848 TTTTAAAGACATGAAGAGTAGGG + Intergenic
1178370625 21:32024065-32024087 CTTTAAGGAAGGGAAGAGGAAGG - Intronic
1178792334 21:35712022-35712044 GTGAAAACACAGGGAGAGGATGG - Intronic
1178809947 21:35872412-35872434 CTGTAAGGTCAGTAAGAGCAGGG + Intronic
1179107329 21:38414180-38414202 ATGTGAAGACAGGCAGAGGTTGG - Intronic
1180050561 21:45329244-45329266 TGGTAAAGGCAGGCAGAGGATGG - Intergenic
1180201073 21:46224628-46224650 CTGTAAAATCAGGAAGATGCTGG - Intronic
1180762020 22:18217716-18217738 CTATAAAGACAGAAAGAGATTGG + Intergenic
1180773647 22:18406894-18406916 CTATAAAGACAGAAAGAGATTGG - Intergenic
1180804996 22:18656438-18656460 CTATAAAGACAGAAAGAGATTGG - Intergenic
1180805747 22:18712970-18712992 CTATAAAGACAGAAAGAGATTGG + Intergenic
1181069704 22:20325610-20325632 CTATAAAGACAGAAAGAGATTGG - Intergenic
1181192746 22:21153819-21153841 CTATAAAGACAGAAAGAGATTGG - Intergenic
1181216696 22:21338755-21338777 CTATAAAGACAGAAAGAGATTGG + Intergenic
1182650732 22:31849091-31849113 CTCAAAAGACAGGAAGATGTGGG - Intronic
1182953774 22:34401835-34401857 GTGAAAAGCAAGGAAGAGGAAGG - Intergenic
1184157528 22:42678040-42678062 CTCAAAAGACAGGAAGATGTGGG + Intergenic
1184387135 22:44182635-44182657 CTGAAAAGGGAGGAAGAGGGAGG + Intronic
1184600045 22:45538069-45538091 CTGGAAGGACAGTAAGGGGACGG - Intronic
1184943706 22:47786333-47786355 GTGAAAAGACAGGAAAAGAAAGG - Intergenic
1185090734 22:48770697-48770719 CTGCAAAGACTAGAAGTGGAAGG - Intronic
1203235477 22_KI270731v1_random:147868-147890 CTATAAAGACAGAAAGAGATTGG - Intergenic
949662733 3:6298984-6299006 CTGTCAGGAGAGGTAGAGGAGGG - Intergenic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952260906 3:31739269-31739291 AAGAAAAGAAAGGAAGAGGAGGG + Intronic
952958866 3:38577325-38577347 TTGCAAGGACAGGAAGTGGAGGG - Intronic
953037623 3:39227073-39227095 GTGGAAAGAGAGGGAGAGGAGGG - Intergenic
953042436 3:39267283-39267305 GTGGAAACAAAGGAAGAGGATGG - Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
953570774 3:44069737-44069759 CTGAAAAGTCAGGAAGAAAACGG + Intergenic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
955527381 3:59835448-59835470 CTGCAAAGACACAAAGAAGAAGG + Intronic
956347705 3:68298991-68299013 CTCAAAAGACAGGAAGATGTGGG + Intronic
956457129 3:69433413-69433435 GTGTAAAAACAGGACAAGGAGGG + Intronic
956621993 3:71230461-71230483 CTGGAAACAAAGGAACAGGAGGG + Intronic
956782687 3:72616786-72616808 CTGTGAAGCCAGGAAGAGCTGGG - Intergenic
957633636 3:82752285-82752307 CAGGAAAGAAAGGAAGAGAAAGG - Intergenic
957798147 3:85039044-85039066 GAGAAAAGAGAGGAAGAGGAAGG + Intronic
957842080 3:85685004-85685026 CTGTAATCCCAGCAAGAGGAGGG + Intronic
958005960 3:87812235-87812257 CTCAGAAGACAGGAAGATGAGGG + Intergenic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
960440491 3:117681390-117681412 AGGTAAAGACAGGAAAAGGAAGG - Intergenic
960647142 3:119898663-119898685 CCGTATATACAGGAAGAGTAGGG - Intronic
960724829 3:120659605-120659627 CTCAGAAGACAGGAAGATGAGGG - Intronic
961831063 3:129623290-129623312 CTGTGAAGACAGGAGGGAGAAGG + Intergenic
961914334 3:130356038-130356060 ATGCAAAAAAAGGAAGAGGAGGG - Intronic
961924863 3:130467907-130467929 TTGGAAAGACAGGAAGTAGATGG - Intronic
963501707 3:146135172-146135194 CTTTCAAGACAGTATGAGGATGG - Intronic
963617348 3:147558696-147558718 CTGTTAGGAAAGGGAGAGGAGGG - Intergenic
963623917 3:147647060-147647082 CTGTAATGACATGAAGGTGAGGG + Intergenic
964703295 3:159592454-159592476 TTGTAAGGACAGGATGGGGAAGG - Intronic
965341974 3:167502463-167502485 CTCAGAAGACAGGAAGATGAGGG + Intronic
965380457 3:167981751-167981773 CTGTAAAAACAAGAAGAAGAAGG - Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
966164755 3:177005331-177005353 CTCAAATGACAGGAAGATGAGGG + Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966523856 3:180900264-180900286 CTTTCCACACAGGAAGAGGAGGG - Intronic
967044922 3:185727611-185727633 AAGTAAATATAGGAAGAGGAAGG - Intronic
967559825 3:190904957-190904979 CTCAAAAGACAGGAAGATGTGGG + Intergenic
967599585 3:191369896-191369918 CTGCAAAGACAAGAGGAGAATGG - Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
968141948 3:196265583-196265605 ATGTAAAGAAAGGAATAGGAAGG - Intronic
968351006 3:198051868-198051890 CTTTGAAGACAGGAAGATGAGGG - Intergenic
969246436 4:5936263-5936285 TTAGAAAGACAGAAAGAGGATGG + Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969903241 4:10369442-10369464 ATGTGAAGATAGGAGGAGGAGGG + Intergenic
970545785 4:17128701-17128723 CTGTATAGCCAGGAAGACGTAGG + Intergenic
970913794 4:21309204-21309226 CTTTAAAGAGAAGAAGAGAAAGG + Intronic
971954971 4:33405512-33405534 CAGTAGAGAAATGAAGAGGAAGG + Intergenic
972147239 4:36043181-36043203 CTGTAAAGCCAGGAAGAAATAGG - Intronic
973367223 4:49217596-49217618 CTTTGAAGACAGGGAGATGAGGG - Intergenic
973595952 4:52490359-52490381 AAGTAAAGAAAGAAAGAGGAAGG + Intergenic
973694260 4:53474632-53474654 CTGTTACTACAGGGAGAGGATGG + Intronic
974457316 4:62144933-62144955 CTCAGAAGACAGGAAGATGAAGG + Intergenic
975052646 4:69884533-69884555 CTCAAAAGACAGGAAGATGTGGG - Intergenic
975944164 4:79684543-79684565 CTGTAAAGATAGGAAATTGAAGG - Intergenic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976683013 4:87778265-87778287 CTGTAAGTATAGGAAGAAGAGGG - Intergenic
977063880 4:92289004-92289026 CTCAAAAGACAGGAAGATGTGGG - Intergenic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977270274 4:94909651-94909673 ATGTAAAATCAGGAAGAGGGAGG - Intronic
977707474 4:100087465-100087487 CTCAGAAGACAGGAAGATGAAGG - Intergenic
978031319 4:103942332-103942354 CAGTAGAGACATGAAGAGAAGGG - Intergenic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978338259 4:107693216-107693238 CTGTGAAAACAGGAACAGGAGGG + Intronic
978850151 4:113325750-113325772 GTGTAGAGAAAGGAAGATGATGG + Intronic
979791353 4:124785191-124785213 TTGTAAGGACAGAAAGAGAATGG - Intergenic
979808555 4:125005698-125005720 ATGGAAAGAGAAGAAGAGGAAGG - Intergenic
979895963 4:126157327-126157349 CTCAAAAGACAGGAAGAGGTAGG - Intergenic
980090932 4:128442276-128442298 CTCAGAAGACAGGAAGATGAGGG - Intergenic
980545363 4:134254950-134254972 CTGCAAAAACTGGAAGAGGTGGG - Intergenic
980706474 4:136503063-136503085 GAGTAAACACAGTAAGAGGAGGG + Intergenic
980981179 4:139655761-139655783 CTGTAAATACTGTAAGAGCAGGG + Intergenic
981265757 4:142781398-142781420 CCTTAAAGACAGAAAAAGGAGGG + Intronic
981638767 4:146911717-146911739 CTTTCAAGACAGGAAGAAAAGGG + Intronic
981903160 4:149890121-149890143 CTGAAGAGAGAGGAAAAGGAAGG + Intergenic
982074672 4:151726816-151726838 AGGCAAAGACAGGAAGAGGATGG - Intronic
982210288 4:153029258-153029280 CTCAGAAGACAGGAAGATGAGGG - Intergenic
983105555 4:163681970-163681992 CTCAAAAGACAGGAAGATGTGGG + Intronic
983178998 4:164625047-164625069 CTGTATAGACCAGAAGAGAATGG + Intergenic
983472677 4:168176052-168176074 TTGGAAAGAAAGGAGGAGGATGG - Intronic
983825655 4:172256143-172256165 TTGAAAAGTCAGGAAGATGATGG - Intronic
983854100 4:172620187-172620209 GTTTAAAGAAAGGGAGAGGAAGG + Intronic
984888094 4:184468769-184468791 CTATCAAGGCAGGAAGGGGAAGG + Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985385051 4:189436751-189436773 CTGAGAAGCCATGAAGAGGAGGG - Intergenic
985394215 4:189524987-189525009 CTCAGAAGACAGGAAGATGAGGG + Intergenic
985432945 4:189898860-189898882 CTGAAAAGTCAGGAAAAGAAGGG + Intergenic
985607595 5:866479-866501 ACTTAAAGACAGGAAGATGAGGG + Intronic
985783192 5:1881430-1881452 CTGGGAGGACAGGAAGAGGGAGG + Intronic
986037607 5:3955062-3955084 CTGTAAGAATAGGAAGAAGAAGG - Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986999178 5:13641609-13641631 CTGTAATGACAGGTACAGTAAGG + Intergenic
987216662 5:15744513-15744535 CTCTGAAGACAGGAAGATGTGGG - Intronic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
987705690 5:21459943-21459965 CTGGAGAGAAAGGAAGAGAAAGG + Intergenic
987826763 5:23040197-23040219 GTGAAAAGACAGGGAGAAGATGG + Intergenic
987952449 5:24692812-24692834 ATACAAAGAGAGGAAGAGGAAGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988544164 5:32141610-32141632 GTGGAAAGAGAGGGAGAGGAGGG - Intronic
988846785 5:35135645-35135667 CTGGAAAGACAGGAAGATACTGG - Intronic
989057579 5:37379754-37379776 CTGGAGAGAGAGGAAGAGAAAGG + Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989169648 5:38461817-38461839 CTCTGACGACAGGAAGAGGGAGG - Intronic
989453492 5:41614639-41614661 CTGAAAAGATAGGAAGAAGTAGG - Intergenic
990173648 5:53083105-53083127 CTATACAGACAGGAAATGGATGG + Intronic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
990725811 5:58753631-58753653 CTGTCTTCACAGGAAGAGGAGGG + Intronic
991510539 5:67371766-67371788 CTGTAAAGGAAGGTAGGGGAAGG + Intergenic
991575604 5:68100219-68100241 CTGTAAGGAAAGCAAGAGAATGG - Intergenic
991970172 5:72133236-72133258 CTGTAAGTACAGGCAGAGGCAGG - Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992817467 5:80458329-80458351 CTGTAGGGAGAGTAAGAGGATGG - Intronic
993117433 5:83734786-83734808 CTCTGAAGACAGGAAGATGTGGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993424256 5:87742828-87742850 GTGGAAAGAGGGGAAGAGGAAGG - Intergenic
993487691 5:88506658-88506680 GTGTAAAGAAAGTAGGAGGAGGG - Intergenic
993826436 5:92692920-92692942 TTATATAGAAAGGAAGAGGAGGG + Intergenic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
995572024 5:113490620-113490642 CTGAGAAGACAGGAAGAACAGGG + Intergenic
995610782 5:113908465-113908487 ATGTGAAGACAGGGAGAAGATGG + Intergenic
995969408 5:117949745-117949767 ATGAGAAGAAAGGAAGAGGAAGG + Intergenic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996543062 5:124649561-124649583 CTGCAAAGAGAGGATGGGGAAGG + Intronic
997399464 5:133591267-133591289 CTGACAAGACAGGGAGAGGAAGG + Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998278484 5:140782042-140782064 CAGAAAAGACAGGAAGATGAGGG + Intergenic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998856179 5:146397438-146397460 CTGGAAAGACACAAAGATGACGG - Intergenic
999343619 5:150795672-150795694 TTCTGAAGACAGGAAGAGGCTGG - Exonic
999377919 5:151099808-151099830 CTGTGAAGACAGCAACAGGCAGG - Intergenic
1000206663 5:159066917-159066939 TTGTAAAGAGAGGAATGGGATGG + Intronic
1000514775 5:162226548-162226570 CTGTAAAGACTGTCAGAGAATGG - Intergenic
1000847402 5:166299062-166299084 ATGTAAAGAAAAGAAAAGGAAGG + Intergenic
1000882672 5:166715838-166715860 ATTCGAAGACAGGAAGAGGAGGG - Intergenic
1002078216 5:176722313-176722335 CTGAAAAGTCAGGAAGCAGATGG - Intergenic
1003020488 6:2505044-2505066 GGGTAAAGACAAGATGAGGAGGG - Intergenic
1003135574 6:3432450-3432472 CTGTAAAACCAGGCAGAGGGAGG + Intronic
1003140791 6:3469628-3469650 CTGAGAGGACAGGGAGAGGAAGG - Intergenic
1003230619 6:4249702-4249724 CTGAAAAGAAAGGAATAGCAAGG - Intergenic
1003525222 6:6891544-6891566 CTGTGAAGGCAGGGAGAGGGAGG + Intergenic
1003735296 6:8871708-8871730 CTGAAAATACAGGAGCAGGAAGG + Intergenic
1004023407 6:11795623-11795645 AGGTAAACACAGGAAGAGAAAGG - Intronic
1004167196 6:13267138-13267160 CAGAGAAGACTGGAAGAGGATGG - Exonic
1004170915 6:13294961-13294983 TTGCAAAGGCAGGAAGAGAAGGG + Intronic
1005172882 6:23008482-23008504 CTGTAAATTCAGTGAGAGGAAGG - Intergenic
1005394521 6:25367572-25367594 CTGTTAAGGCTTGAAGAGGAAGG + Intronic
1006080782 6:31565022-31565044 CTGTGAAGACAGGAAAAGCATGG + Intergenic
1006832919 6:36979648-36979670 CTGGAAGGAGAGGAGGAGGAGGG + Intronic
1007168460 6:39845655-39845677 CACTAAAGACAGGAAGAGAGAGG - Intronic
1008077386 6:47159318-47159340 CTGGAAAGACAGGCAGAAGCTGG + Intergenic
1008172742 6:48229749-48229771 CTATAAAGACAAGTAGAGAAAGG - Intergenic
1008874980 6:56315704-56315726 GTGCAAAAACAGGTAGAGGAGGG - Intronic
1009022602 6:57960930-57960952 CTGGAGAGAGAGGAAGAGAAAGG - Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1009378990 6:63006477-63006499 GGGTAGAGACATGAAGAGGAGGG - Intergenic
1010037847 6:71346586-71346608 TTGTAAACATAGGAAGAAGAGGG - Intergenic
1010485234 6:76403632-76403654 CAGTAATTACATGAAGAGGAAGG + Intergenic
1010605866 6:77889236-77889258 CTGAGAAGACAGGAAGATGTGGG + Intronic
1011544403 6:88468018-88468040 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1012533558 6:100268072-100268094 CTGTCAGGAGAGGAAAAGGAAGG - Intergenic
1012574149 6:100770392-100770414 CTCTAAAACCAGGAATAGGAAGG + Intronic
1012780170 6:103547536-103547558 CTTGGAAGACAGGAAGATGAGGG - Intergenic
1012902749 6:105026275-105026297 CTGTAAAGAGCAGAAGAGGGTGG - Intronic
1013239407 6:108229437-108229459 CTCTAAAGGAAGGAAGGGGAGGG - Intronic
1013827796 6:114235560-114235582 TTGTTAATACAGGAAGGGGAGGG + Intronic
1014286452 6:119504193-119504215 CTATAAGAACAGGAACAGGACGG - Intergenic
1014598137 6:123371605-123371627 CAGTTAAGACATGAAGAGGTAGG - Intronic
1014652138 6:124052943-124052965 CTGAAAAGAGAGGGAGAGTACGG + Intronic
1014942298 6:127456931-127456953 GAGGAAAGACAAGAAGAGGAAGG - Intronic
1015054716 6:128886361-128886383 ATATGAAGACAGGAAGAGAAAGG + Intronic
1015621087 6:135132431-135132453 CTGTAAAGGAAAGAAGAGAAGGG - Intergenic
1015759077 6:136638064-136638086 GTGTAGAGACAGGAAGAGTGAGG - Intronic
1015801618 6:137066192-137066214 CAGTAGAGACAGGGAGAGAAGGG + Intergenic
1015864108 6:137710599-137710621 GTATACACACAGGAAGAGGAAGG + Intergenic
1016388476 6:143551571-143551593 CTGTGATGATAGGAACAGGAAGG + Intronic
1016930197 6:149398450-149398472 TGGAAAAGACAGGAAGGGGAAGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018039475 6:159909390-159909412 CTTTTGAGAAAGGAAGAGGATGG - Exonic
1018093736 6:160366890-160366912 CTCAAAAGACAGGAAGATGTGGG - Intronic
1018273563 6:162106163-162106185 CCGTAAGTACGGGAAGAGGATGG + Intronic
1018385619 6:163300344-163300366 CTGAAGAGTCTGGAAGAGGACGG + Intronic
1018503806 6:164442506-164442528 ATGTAATGAAAGGAAGGGGAAGG - Intergenic
1018592715 6:165444228-165444250 CTCAAAAGACAGGAAGATGAAGG - Intronic
1018779140 6:167046293-167046315 CTAGAAAGAAAGAAAGAGGAAGG + Exonic
1019175399 6:170156941-170156963 CTGGGAAGACAGGAAGCGAAGGG + Intergenic
1019464713 7:1181366-1181388 CTGAAAAGAAAGGGTGAGGAGGG - Intergenic
1019862189 7:3669588-3669610 GTTTAAAGACAGGTGGAGGAAGG - Intronic
1019944991 7:4320575-4320597 CTGTAGAGACAGAAAATGGAAGG - Intergenic
1019985511 7:4652546-4652568 ATGAAAAGACAGGGAGAAGATGG - Intergenic
1020058028 7:5132016-5132038 CGGTGAAAACAGGAAGAGAATGG - Intergenic
1020169495 7:5833969-5833991 CAGTGAAAACAGGAAGAGAATGG + Intergenic
1020565373 7:9788139-9788161 CTTAGAAGACAGGAAGATGAGGG - Intergenic
1021256665 7:18400570-18400592 TTGAAAAGACTGGATGAGGAAGG + Intronic
1021281763 7:18728300-18728322 CTGTAGACAAAGGAAGAGGTTGG - Intronic
1021758734 7:23882314-23882336 CTTAGAAGACAGGAAGATGAGGG - Intergenic
1021968005 7:25941087-25941109 TTGTTCAGAAAGGAAGAGGAAGG + Intergenic
1023030751 7:36088592-36088614 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1023409972 7:39880506-39880528 CATTAAAGGAAGGAAGAGGAGGG - Intergenic
1023682985 7:42706788-42706810 CGCTACAGACAGGAAGAGGAGGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024015241 7:45307672-45307694 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1024087530 7:45908345-45908367 CTCTAGACACAGGAAGATGAGGG - Intergenic
1024482781 7:49882457-49882479 CTGTAAAGAGAAAGAGAGGAAGG + Intronic
1024674523 7:51626237-51626259 CTGTGAATACACCAAGAGGAAGG + Intergenic
1026003844 7:66584719-66584741 CTGTAAACACAGGAAGAAACAGG + Intergenic
1026299710 7:69086671-69086693 CTGTGAAGACAGGATGCAGAAGG + Intergenic
1026941176 7:74289022-74289044 CTGGACAGAAAGGATGAGGAGGG - Intergenic
1027513187 7:79109223-79109245 CTCGAAGGACAGGAAGATGAGGG + Intronic
1027649286 7:80845461-80845483 CTGTAAAGACAAGCAGCGAATGG + Intronic
1028462440 7:91110619-91110641 ATGTAAATACAAGAAGAGAAAGG - Intronic
1029436752 7:100568042-100568064 CAGGAAAGGCAGGAAGAGCAGGG - Exonic
1029530785 7:101123864-101123886 CTGGTATGACAGGCAGAGGAAGG + Intergenic
1029595758 7:101536895-101536917 ATGTAAAGGCAGGAAGTGGAGGG + Intronic
1029983516 7:104901155-104901177 TTGTAAAGAGAGTAAGTGGAAGG - Intronic
1030108670 7:106008264-106008286 CTGGAAAGAGAAGGAGAGGAGGG + Intronic
1030415391 7:109237527-109237549 CTCAAAAGACAGGAAGATGTGGG + Intergenic
1031460928 7:122047730-122047752 CAGTTAAGCCAGGGAGAGGAAGG - Intronic
1031835251 7:126673552-126673574 CTATAAAGACAGTGGGAGGATGG - Intronic
1032364125 7:131283396-131283418 CAGTAAAGAGAGAGAGAGGAAGG - Intronic
1032430820 7:131860078-131860100 CTTTGAGGACTGGAAGAGGATGG - Intergenic
1032596806 7:133249502-133249524 GTGAAAAGACAGGCACAGGATGG - Intergenic
1034276754 7:149827206-149827228 CTGTGATGCCAGGAAGTGGAAGG + Intergenic
1034721086 7:153293544-153293566 CCTTAAAGATGGGAAGAGGATGG + Intergenic
1034941404 7:155232656-155232678 CTGCAAAGCTGGGAAGAGGAAGG + Intergenic
1035228564 7:157446934-157446956 CCTTAAAGCCAGGATGAGGAGGG - Intergenic
1035416604 7:158694513-158694535 CTGTCAAGACAGGAAGCGCATGG - Intronic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1036001316 8:4608121-4608143 GTGTGAAGACAGGAAGAGGGAGG + Intronic
1036417908 8:8567333-8567355 AAGAAAAGACAGGAAGAGAAAGG - Intergenic
1037689859 8:21172592-21172614 GTCTAAAGCCAGGAAGAGGAAGG + Intergenic
1037701129 8:21274697-21274719 CTGTTAACACAGGGAGTGGAGGG - Intergenic
1037909542 8:22735704-22735726 CTGTCAAGAGAGGAGGAGGGTGG + Intronic
1039548679 8:38428255-38428277 CTGAAAGGGGAGGAAGAGGAGGG - Intronic
1039668256 8:39561775-39561797 CTGAAAGGACAGGAAGGGGAGGG - Intergenic
1039680276 8:39727731-39727753 AGATAAAGACAGGAAGATGAGGG - Intronic
1039966211 8:42285868-42285890 CCGTAGAGACAGAAAGAGGTGGG + Intronic
1040694505 8:49979533-49979555 GTGTGCAGACAGGCAGAGGAAGG - Intronic
1040873419 8:52124688-52124710 CTGGAAAGACTGGAAGAGGCAGG + Intronic
1042058079 8:64787561-64787583 CTTTGAAGACAGGAAGATGTGGG - Intronic
1042604032 8:70528300-70528322 CTGCAAAGACAGGGAGAAGCTGG + Intergenic
1042923895 8:73947341-73947363 GTGTGAAGACAGGAAGAAGATGG + Intronic
1042945253 8:74147667-74147689 CTGGAAAGAAAGGCAGAGGAAGG - Intergenic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1044351050 8:91167058-91167080 GGGTAAAGAAAGCAAGAGGAGGG + Intronic
1044896906 8:96902173-96902195 CTGAAAAGAAAGGAAGTGAAGGG + Intronic
1045778312 8:105833212-105833234 GTGGAAAGAAAGGAAGAGGCAGG + Intergenic
1045791242 8:105987289-105987311 CTTAAAAGACAGGATGATGAGGG + Intergenic
1045951476 8:107856158-107856180 ATGTAAAGACAGGATGCTGAGGG - Intergenic
1045961748 8:107976791-107976813 TTTAAAAGAAAGGAAGAGGAGGG - Intronic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047318899 8:123760494-123760516 CTGTAAATAAGGGAAGAGGATGG - Intergenic
1047601977 8:126434724-126434746 CAGTTAAAAGAGGAAGAGGAAGG + Intergenic
1047795418 8:128250113-128250135 CAGTAATCACAAGAAGAGGAAGG + Intergenic
1047900330 8:129414416-129414438 CTTTAAAGTCAGGAAAAGCAGGG - Intergenic
1048875217 8:138831747-138831769 CTAAAAGGCCAGGAAGAGGAAGG - Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1050085100 9:1957141-1957163 CTGGGAAGGCAGGAAGCGGAAGG - Intergenic
1050443605 9:5693830-5693852 GTGAAAAGACAGGAAGAAGGGGG - Intronic
1050575702 9:6993077-6993099 CTGTAATTACAGGATCAGGAAGG + Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1052330245 9:27260299-27260321 GTGTAAAGACAGCAAGGGAAAGG + Intergenic
1052517065 9:29495673-29495695 CTGAAAAGAGCTGAAGAGGAAGG - Intergenic
1053020697 9:34691865-34691887 CAGTAAATAGAGGAAGGGGAGGG - Intergenic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053169062 9:35865405-35865427 GTGAAAGGACAGGAAGGGGAGGG - Intergenic
1053196963 9:36127005-36127027 TTGTAGAGGCAGGGAGAGGAAGG - Intergenic
1053722099 9:40956887-40956909 CTGAAAAGTCAGGAAAAGAAGGG + Intergenic
1054343871 9:63895086-63895108 CTGAAAAGTCAGGAAAAGGAGGG - Intergenic
1054754566 9:68944710-68944732 CTGTAATGGCAGGAAGAAGAGGG - Intronic
1055049114 9:71961703-71961725 CTTTAAAGACAGTAAGACCATGG - Intronic
1055170660 9:73254272-73254294 CTCAGAAGACAGGAAGATGAAGG + Intergenic
1055425962 9:76197048-76197070 CTGGGAAGACAGGAAGAGAGCGG + Intronic
1055774541 9:79753285-79753307 CTCAAAAGACAGGAAGATGTGGG - Intergenic
1056483206 9:87027853-87027875 GAGTAAAGGCAAGAAGAGGAGGG + Intergenic
1057239406 9:93395213-93395235 CTCAGAAGACAGGAAGATGAAGG - Intergenic
1057488001 9:95501013-95501035 CTATAAATACAGGAATGGGATGG + Intronic
1058698118 9:107576968-107576990 GTGTGAAGAAAGGAAGAAGAGGG - Intergenic
1058707768 9:107651508-107651530 CTGTAAAAACAAGAAGAATAAGG - Intergenic
1060046378 9:120344583-120344605 CTGGAAAGACAGCAAGGGCAGGG - Intergenic
1060074223 9:120577593-120577615 CTGCAAAGGCAGGGAGATGAGGG + Intronic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1061191513 9:129085285-129085307 CCTTAAATACAGGAAAAGGAAGG - Exonic
1061609699 9:131738572-131738594 CTGTCCAGACAGCAAGAGGGCGG - Intronic
1062437867 9:136554624-136554646 CTGGGAAGACAGGCAGAGGCTGG + Intergenic
1062455420 9:136634921-136634943 CTGTAGGGAAAGGAAGAGGAGGG + Intergenic
1203453073 Un_GL000219v1:139070-139092 CTGAAAAGTCAGGAAAAGAAGGG - Intergenic
1185918218 X:4059822-4059844 GTTTAGTGACAGGAAGAGGAGGG + Intergenic
1187364564 X:18655900-18655922 CTCTAGAGCCAGGAAGATGAGGG - Intronic
1188657525 X:32716659-32716681 CTCAGAAGACAGGAAGATGAGGG + Intronic
1188875952 X:35430409-35430431 CTGTTAACACAGGAAGAAAAGGG + Intergenic
1188983195 X:36746821-36746843 CAGAAGAGACAGGAAGAAGAGGG - Intergenic
1189322139 X:40093390-40093412 TCTTAAAGAAAGGAAGAGGAGGG + Intronic
1189656719 X:43252164-43252186 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1192034605 X:67548211-67548233 TAGTAAAGAAAGAAAGAGGAGGG + Intronic
1192822939 X:74663711-74663733 TTTTAAAGGCAGGAAGAGGCTGG + Intergenic
1193814333 X:86086602-86086624 CTCCAAAGACAGGAAGATGTGGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1195070427 X:101273741-101273763 ATTTAAAGCCAGGAAGAGAATGG - Intronic
1196831297 X:119777548-119777570 ATGTAAGGAGAGGGAGAGGAAGG + Intergenic
1197203248 X:123767418-123767440 ATGTAAAAATAGGTAGAGGAAGG - Intergenic
1197287942 X:124617965-124617987 CTGTGATGACATGAAAAGGAAGG - Intronic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197922795 X:131613102-131613124 CTGTAAAAACAGGCAGTGGGGGG - Intergenic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198806551 X:140500668-140500690 ATGTAAAACAAGGAAGAGGAGGG + Intergenic
1199228582 X:145408949-145408971 CTATGAAGACAGGAAGATGTGGG + Intergenic
1199423545 X:147675462-147675484 CTCAGAAGACAGGAAGATGAAGG + Intergenic
1199608064 X:149592479-149592501 CTGCAAAGAAAGAAAAAGGATGG + Intergenic
1199631056 X:149776881-149776903 CTGCAAAGAAAGAAAAAGGATGG - Intergenic
1199699499 X:150365072-150365094 CTATAAAGACAAGAAGAGGTGGG - Intronic
1200176287 X:154118824-154118846 CTGTAAAAAAAGGAAAAGGAAGG - Intergenic
1200358289 X:155575169-155575191 ATGTGAAGACAGGGAGAAGATGG - Intronic
1201140848 Y:11026796-11026818 CTGGAAAGAAAGGAATAGAATGG - Intergenic
1201299893 Y:12496444-12496466 CTGTAAAGACAGGGAGAAGACGG - Intergenic
1201442246 Y:14020992-14021014 CTGTAAAAAAAGGGAGAGGAAGG - Intergenic
1201604117 Y:15766213-15766235 AAGTAAAGATGGGAAGAGGAAGG - Intergenic
1201724399 Y:17137171-17137193 CTGTGAAGACAGGAATAGCTGGG - Intergenic
1201898708 Y:19023337-19023359 CTGAAAAGAAAGCAAGTGGAAGG + Intergenic
1201918733 Y:19210755-19210777 CTTTAAAGTCAGGAACAGGTGGG - Intergenic