ID: 1198229578

View in Genome Browser
Species Human (GRCh38)
Location X:134676298-134676320
Sequence AAAGTGCACCAGGCCTCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198229578 Original CRISPR AAAGTGCACCAGGCCTCGGC AGG (reversed) Intronic
904441309 1:30533839-30533861 ATAGTGCCCCAGGTCACGGCTGG - Intergenic
906502089 1:46348787-46348809 ACAGTGCACAAGGCCTTCGCTGG - Intronic
912706778 1:111920614-111920636 AGAGTGCACCAGCCCTGGGCTGG - Intronic
915321270 1:155057672-155057694 ACTGTGCACCTGGCCTCAGCTGG - Exonic
916438295 1:164797249-164797271 CAAGTGCACCAGCTCTCAGCTGG - Intronic
917477412 1:175380590-175380612 AAGGTGCCCAAGGCCTGGGCTGG + Intronic
919795219 1:201317629-201317651 AACGTCCAGCAGGCCGCGGCAGG + Exonic
920456638 1:206106728-206106750 AAAGTGGGCCTGGCCTCCGCTGG - Intergenic
1063641551 10:7835713-7835735 AAGGGCCACCAGGCCTCTGCTGG - Intronic
1064125411 10:12655684-12655706 AAAGACCGCCAGGCCTCAGCTGG + Intronic
1066651009 10:37654987-37655009 AAAGACCACCAGGTCTGGGCAGG - Intergenic
1070167478 10:73909687-73909709 AAAATGCTGCAGGCCTAGGCTGG + Intronic
1071294006 10:84206218-84206240 AAAGTGCAGCAAGCCCAGGCTGG + Intronic
1073920329 10:108451083-108451105 GAAGTTGACCAGGCCTAGGCTGG - Intergenic
1074491398 10:113942434-113942456 AAAGCTCACCTGGCCTTGGCTGG + Intergenic
1077556339 11:3227870-3227892 TATGTCCACCAGGCCCCGGCGGG + Exonic
1078218520 11:9332238-9332260 AAAGTGTACCAGTCCTGGCCCGG - Intergenic
1082855133 11:57799200-57799222 CAGGAGCACCAGACCTCGGCTGG + Intronic
1085047604 11:73362621-73362643 AAAGGGCACCAGCTCTGGGCGGG - Exonic
1085418267 11:76334254-76334276 AGAGAGCACCAGGCCTCAGATGG - Intergenic
1090806368 11:130204857-130204879 AGAGTGGACCAGGGCTCGGGTGG + Intronic
1093294238 12:17367911-17367933 AGAGTGCACCAGGCCTCCCAAGG - Intergenic
1093970691 12:25373266-25373288 AAAGTGGACAAGGACTCAGCCGG - Intergenic
1102645540 12:114401251-114401273 AAACTGAACCGGGGCTCGGCCGG - Intronic
1102929451 12:116851184-116851206 AAACTGTACCAGGCCTCTGTTGG - Exonic
1103069290 12:117927394-117927416 AAAAAGGACCAGGCCTTGGCTGG + Intronic
1104180845 12:126378999-126379021 AGAGTGCTCCAGGCATAGGCAGG + Intergenic
1104789600 12:131473316-131473338 AGAGTCCACCCGGCCTCAGCAGG + Intergenic
1107000569 13:35539623-35539645 AAAGTGCACTAGGGCCGGGCGGG + Intronic
1121595121 14:95156892-95156914 CAAGAGCCCCAGGCCTCGCCAGG + Intronic
1122711737 14:103663586-103663608 ACAGCGCACCAGGCCTCAGAAGG - Intronic
1124497555 15:30195828-30195850 AAGGGGCACCAGGTCTTGGCGGG - Intergenic
1124746034 15:32342863-32342885 AAGGGGCACCAGGTCTTGGCGGG + Intergenic
1127755471 15:62087741-62087763 AAAGATCACCAGGCTTAGGCTGG - Intergenic
1132520335 16:384297-384319 CAAGTTCACCAGCCCTCAGCTGG - Intronic
1132611028 16:816407-816429 CAAGGGCACCAGGCCTCCCCTGG - Intergenic
1137675997 16:50304156-50304178 AGAGTGCACCAGGCTTTGGCTGG + Intronic
1144764702 17:17726051-17726073 AAAGCCCAACAGGACTCGGCTGG + Intronic
1147584852 17:41648254-41648276 CCAGAGCACCAGGCCCCGGCTGG + Intergenic
1150588575 17:66540575-66540597 AAAGTGCAGCAGGGCCCCGCTGG - Intronic
1151602742 17:75116329-75116351 AAAGAGTACCAGACCTAGGCCGG + Intronic
1152710183 17:81867465-81867487 ACAGTGCAGAAGGCCTTGGCTGG - Intergenic
1161060370 19:2211652-2211674 AACGAGTCCCAGGCCTCGGCAGG - Intronic
1162752972 19:12840279-12840301 AAGGTGGTGCAGGCCTCGGCAGG - Intronic
1162917099 19:13880523-13880545 CAAGGGCACCCGGGCTCGGCTGG + Intronic
1163061505 19:14765248-14765270 AAACTGCCCCAGGCCTCTGTGGG + Intronic
1163757262 19:19113493-19113515 CAAGAGCACCAGGCCTGTGCTGG - Intergenic
1166670103 19:44704433-44704455 AAAGTGCACTTGCCCTCGCCAGG + Intronic
1168682843 19:58328470-58328492 ACTGTGCACCAGGCCTGTGCTGG + Intronic
925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG + Intergenic
926158150 2:10469454-10469476 AGAGTGCACAAGGCCTCCCCTGG - Intergenic
926290757 2:11527804-11527826 AAAGTGCAGGAGGCCTGGGAGGG + Intergenic
932596361 2:73096085-73096107 AAAGTTCACCAGGCCCCGTGTGG + Intronic
938744179 2:134261319-134261341 AAAGAGCACCAGGACACAGCTGG - Intronic
947607795 2:231500410-231500432 AAAGTGCACCAGGCCAGGCATGG - Intergenic
949028463 2:241777167-241777189 AAGCAGCACCAGGCCTGGGCAGG - Intronic
1168931719 20:1629784-1629806 AAAGGGCATCAGGACTTGGCAGG - Intronic
1168962855 20:1880771-1880793 ACAGTGGACCAGGGCTGGGCTGG + Intergenic
1169600470 20:7254087-7254109 GAAGAGAACAAGGCCTCGGCTGG - Intergenic
1171937199 20:31286198-31286220 GAAGTGTACCAGGCCTCTGTGGG - Intergenic
1174484501 20:50852676-50852698 AAAATGTGCAAGGCCTCGGCCGG - Intronic
1176150890 20:63590195-63590217 AACGTGGCCCAGGCCTCGCCTGG - Exonic
1178585281 21:33866248-33866270 AGAGTGCCCCATGCCTTGGCTGG - Intronic
1180940922 22:19659111-19659133 AATGGACACCAGGCCTCGGGTGG + Intergenic
1185028092 22:48426996-48427018 CAAGCGCACCAGACCTCAGCAGG - Intergenic
950216603 3:11164197-11164219 AAAGAGCACACGGCCTGGGCTGG + Intronic
957193569 3:77039977-77039999 ATAGTGCACCAGGCGGCTGCGGG - Intronic
961368003 3:126413600-126413622 AAAGTGCTTCAGGCCTGGGGAGG - Intronic
969275753 4:6134788-6134810 ATACTGCACCAGGCCTGGGGAGG + Intronic
969490517 4:7496890-7496912 ACAGGGCACCTGGCCTCGCCTGG - Intronic
969872820 4:10115560-10115582 AAAGTGCACCAGGCACCGCTGGG + Intronic
972565047 4:40262212-40262234 AAATTGCCCCAGGCCTGGTCTGG + Intergenic
978077634 4:104552869-104552891 GAAGTGCACAAGGCCTCTTCAGG + Intergenic
986823557 5:11496277-11496299 CAGGTGCACCAGGCCAGGGCTGG + Intronic
997336955 5:133115210-133115232 AAGGGGCACCAGGCATCAGCAGG - Intergenic
997388573 5:133495220-133495242 AAACTCGACCAGGCCTCTGCGGG + Intronic
997585317 5:135040050-135040072 AAAGTGCCCCAGGGCCAGGCTGG - Intronic
997866877 5:137471727-137471749 AAAGTGCACCATGCCTAGGAGGG + Intronic
1002175448 5:177398951-177398973 GAACTGCACCTGGCCTGGGCAGG - Intergenic
1002839135 6:890840-890862 AAAGTGCAGGAGGCCTGGGCAGG + Intergenic
1005298894 6:24451884-24451906 AAAATGAACCAGTCCTCAGCTGG - Intronic
1007451106 6:41940973-41940995 AAAGTGCAGGAGGCAGCGGCAGG - Intronic
1014741727 6:125154479-125154501 AACGTTCACCTGGCCTCGGAAGG - Intronic
1016580873 6:145628406-145628428 AGAGTCTACCAGGCCTCAGCAGG - Intronic
1017441866 6:154472069-154472091 AAAGAGCACCTGCCCTGGGCAGG + Intronic
1019339578 7:502561-502583 AAAGCGAACCAGACCTCAGCTGG + Intronic
1023030815 7:36089241-36089263 ACAGTGCACCAAGGCTGGGCAGG - Intergenic
1027189129 7:75987797-75987819 AAACTGCACGAAGCCTGGGCCGG + Exonic
1031072699 7:117179757-117179779 AAATTGCCCCAGGCCTCTCCAGG - Intronic
1032385415 7:131519397-131519419 ATAGAGGACCAGGCCTGGGCTGG - Intronic
1035207943 7:157306958-157306980 CAAGTCCACCAGGGCTCAGCGGG - Intergenic
1036620554 8:10422299-10422321 AAAGTGCACCATGCCCTGCCTGG - Intronic
1048579599 8:135720097-135720119 GAAGTGCACCAGGCAGGGGCAGG - Intergenic
1049377708 8:142296845-142296867 CGACTGCACCAGGCCTGGGCGGG + Intronic
1049938374 9:521392-521414 TAGGTGCACCAAGCCTCAGCTGG + Intronic
1053479426 9:38405018-38405040 CCAGTGCACCAGGCATCGCCAGG - Intergenic
1186738103 X:12487596-12487618 AAAGTGCACCAAGCCTCATAGGG - Intronic
1192510390 X:71717679-71717701 AAATGGCAGCAGGCCTCTGCCGG - Exonic
1192516307 X:71763874-71763896 AAATGGCAGCAGGCCTCTGCCGG + Exonic
1196733239 X:118962512-118962534 AAAATGCACGAGGCCTCAGAGGG + Intergenic
1198226068 X:134647110-134647132 AAAGTACCCCAGGCCTCCGAAGG + Intronic
1198229578 X:134676298-134676320 AAAGTGCACCAGGCCTCGGCAGG - Intronic
1198694948 X:139325514-139325536 GAAGTTCCCCAGGCCTCAGCTGG - Intergenic