ID: 1198229738

View in Genome Browser
Species Human (GRCh38)
Location X:134677620-134677642
Sequence TAGTGAGTAAGGAGAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198229735_1198229738 -6 Left 1198229735 X:134677603-134677625 CCAGAGTGGCTGGAACGTAGTGA 0: 1
1: 0
2: 7
3: 83
4: 433
Right 1198229738 X:134677620-134677642 TAGTGAGTAAGGAGAGTGGTAGG 0: 1
1: 0
2: 5
3: 20
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198229738 Original CRISPR TAGTGAGTAAGGAGAGTGGT AGG Intronic
900820610 1:4884426-4884448 GAGAGAGAAAGGAGAGTTGTGGG + Intergenic
901830918 1:11891993-11892015 TAGTGAGTGAGGGAAGGGGTGGG + Intergenic
906254860 1:44340595-44340617 CAGTGAGTCAGGAGAGAGATGGG - Intronic
910516006 1:88061020-88061042 TAGTGATTGAAGAGATTGGTTGG + Intergenic
910937365 1:92495303-92495325 TTGTGATTAAGGAGAGAAGTGGG - Intergenic
911007316 1:93240834-93240856 TACTGAGTTAGGAGAAGGGTAGG - Intronic
912111974 1:106354529-106354551 TAGTCATTTAGGAGAGTAGTTGG + Intergenic
913203556 1:116515633-116515655 TAGTGGGTGAGGAGACTGCTGGG - Intronic
915112465 1:153572945-153572967 AAGTGACTCAGGAGAGTGGGTGG + Intergenic
915599727 1:156914586-156914608 GAGGGAGTGGGGAGAGTGGTGGG + Intronic
918126780 1:181590769-181590791 TGGTGAGTGGGGAGAGTGGGAGG - Intronic
918428490 1:184434800-184434822 TCGTGAGCAAGGAGAATGGAGGG + Intronic
919137809 1:193532651-193532673 TACTGAGTAATGGGATTGGTGGG - Intergenic
920503646 1:206501279-206501301 GAGTGAGAAAGGAGAGAGGGAGG + Intergenic
921527559 1:216236642-216236664 CTGTGAGTCATGAGAGTGGTTGG + Intronic
922657354 1:227397354-227397376 TAGTAAGTGAGGAGCGTGGTAGG - Intergenic
922761001 1:228130596-228130618 TAGAGAGGAAGGAGAGTGGTGGG - Intergenic
922868724 1:228883067-228883089 TAGTGAGGGAGGAGCTTGGTGGG + Intergenic
924009801 1:239652567-239652589 TAGTGAGGAAGAAGCGTTGTTGG + Intronic
924646881 1:245886308-245886330 TAATAAGTAAGGAGAGATGTGGG - Intronic
1063288463 10:4715193-4715215 TGGTGAGAAAGGAGAGTGGAGGG - Intergenic
1063811296 10:9711676-9711698 TAGTGTCTAAGGAGAGAGCTAGG + Intergenic
1064710862 10:18123161-18123183 TAGTGAGGCAGGAGACTGGCAGG + Intergenic
1066230702 10:33429983-33430005 TAGGGGGGAAGGAGAGTGATAGG + Intergenic
1067147285 10:43702829-43702851 TAGGGAAGAAGGAGGGTGGTGGG + Intergenic
1069290388 10:66772003-66772025 TTGTGTGTAAGGAGAGTGAGTGG + Intronic
1070644028 10:78189060-78189082 TAGTAAGTGAGGAGAAGGGTGGG - Intergenic
1071680050 10:87695747-87695769 TAGAGAGGAAGGAGAGCAGTAGG + Intronic
1072198479 10:93137606-93137628 TTCTGAGGAAGAAGAGTGGTGGG - Intergenic
1075244791 10:120811320-120811342 CAGAGAGGAAGGAGAGAGGTGGG - Intergenic
1077522401 11:3044084-3044106 TTGTGAGGGAGGAGAGTGATGGG - Intronic
1077895530 11:6450702-6450724 TAGGGTGTTAGGAGAGGGGTGGG + Intronic
1080529491 11:33161278-33161300 AGGTGAGGAAGGAGAGTGGTGGG - Exonic
1084874649 11:72121953-72121975 TAGAGACTAAGTAGAATGGTGGG - Intronic
1085853085 11:80144043-80144065 AAGGGAGTGAGGAGAGTTGTAGG - Intergenic
1086445463 11:86866341-86866363 CAGTCAGTAAGGAGAATGGTAGG + Intronic
1086545039 11:87957842-87957864 TCGTTAGGAAGGAGATTGGTAGG - Intergenic
1086759439 11:90609349-90609371 GAGAGAGTGAGCAGAGTGGTAGG + Intergenic
1087250440 11:95893080-95893102 TAGTGAGTGAGGAGGATGGGTGG - Intronic
1089498616 11:118920118-118920140 CAGTGAGGAAGCAGAGTGCTGGG - Intronic
1089592395 11:119551845-119551867 CAGTGAGTCAGGAGAGTGGCTGG + Intergenic
1090783627 11:130029200-130029222 TAGTAAGAAAGGAGAATTGTTGG - Intergenic
1091144429 11:133265234-133265256 TAGTGAGGAAGAAGTGGGGTGGG + Intronic
1092099189 12:5869269-5869291 TAATGAGCAGGGAGACTGGTAGG - Intronic
1096318444 12:50589673-50589695 CAGTGAGTTAGGAGAGTGGTGGG + Intronic
1096814793 12:54195288-54195310 CAGTGAGGGAGCAGAGTGGTAGG - Intergenic
1096848602 12:54421165-54421187 GACTGAGAAAGGAGAGTGTTTGG - Intergenic
1097462348 12:59877404-59877426 TAGTGAATAAGGAAAGAGGGAGG - Intergenic
1097925041 12:65117858-65117880 TAGTCAGTAAGGAGAGGGATGGG + Intronic
1099003352 12:77207256-77207278 TAGTGAGAAATGAGAGTCCTTGG - Intergenic
1099233301 12:80052499-80052521 GAGTGAGTAAGAAGAGTGGTAGG - Intergenic
1099874540 12:88388935-88388957 TAGGCAATCAGGAGAGTGGTTGG + Intergenic
1102214155 12:111148337-111148359 GAGAGAGAAAGTAGAGTGGTGGG + Intronic
1102651311 12:114444452-114444474 TAGTGAATGAGGAGAATGTTAGG - Intergenic
1102844563 12:116165712-116165734 TCTTGAGGAAGGTGAGTGGTTGG - Intronic
1103397718 12:120620785-120620807 TGGTGAGTCAGGAGTGTGTTGGG + Intergenic
1105638687 13:22240465-22240487 AAGTGAGGAAGGGGAGTGCTGGG - Intergenic
1105661594 13:22501798-22501820 TAGCTAGTAAGGAGAAGGGTGGG - Intergenic
1105865869 13:24458712-24458734 TAGTGAGTTAGGTGGGTGGAGGG + Intronic
1105989078 13:25600347-25600369 CTGTGAGTGAGGAGTGTGGTTGG + Intronic
1106005222 13:25763567-25763589 TAGTGGGAAAGGATAGTGGCAGG - Intronic
1108222577 13:48251771-48251793 TAGAGTGGAAGGAGAGTGGGGGG - Intronic
1108324034 13:49312686-49312708 TAGTGACTTAGGAGAGTGATAGG - Intronic
1109065130 13:57677589-57677611 CAGTAAGGAAGGAGAGGGGTAGG + Intronic
1111344265 13:86927751-86927773 TAGTAAGTAAGTGGAGTTGTAGG + Intergenic
1112827669 13:103410814-103410836 TAGTGAGAAAGGATAAAGGTAGG - Intergenic
1112921462 13:104617792-104617814 TACTTAGTAAGGACAGTGTTTGG + Intergenic
1113615685 13:111678928-111678950 TAGTCAGTAAGAAGAGTGACTGG + Intergenic
1113621153 13:111763830-111763852 TAGTCAGTAAGAAGAGTGACTGG + Intergenic
1115796277 14:36939558-36939580 TTGGGAGAAAGGAGAGAGGTTGG - Intronic
1116126507 14:40795407-40795429 TAGTGATTAAGGGGTGAGGTTGG + Intergenic
1117661930 14:58015352-58015374 TAGTGAGTAAGTATTCTGGTGGG + Intronic
1121686804 14:95841688-95841710 TAGTGAGGAAGGGGAGGGGCTGG + Intergenic
1122527303 14:102396523-102396545 TAGAGAGGAAGGAGAGTATTTGG + Intronic
1202837026 14_GL000009v2_random:85930-85952 TAGTGAGTGAGGTTGGTGGTGGG + Intergenic
1124514251 15:30352753-30352775 AAGGGTGTAAGGAGAGAGGTTGG + Intergenic
1124728668 15:32178011-32178033 AAGGGTGTAAGGAGAGAGGTTGG - Intergenic
1124992247 15:34686842-34686864 TAGAGGGTAGGGATAGTGGTTGG - Intergenic
1127322368 15:57859335-57859357 GGGAGAGTAAGGAGAGTGTTGGG - Intergenic
1128768633 15:70266083-70266105 TGGGGAGTAAGGAGAGTGCCTGG - Intergenic
1129675707 15:77631753-77631775 TGGGGAGTAGGGAGAGTGGAAGG - Intronic
1130393372 15:83479395-83479417 TGGTGAGTAGGGAGAGTGACGGG + Intronic
1130753110 15:86734479-86734501 AAGAGAGTAAGGAGAGGTGTGGG + Intronic
1130839462 15:87684205-87684227 AAGTCAGCAAGGAGAGTGGAGGG + Intergenic
1131046003 15:89316064-89316086 AAGTGGGTAAAGAGAGTGGATGG - Intronic
1131580707 15:93639868-93639890 GATTGAGTGAGGAGAGAGGTTGG + Intergenic
1133035635 16:3032599-3032621 TAGAGAGTAAGGAGTGGGGTGGG + Intronic
1134275486 16:12772162-12772184 TAGTGAGGAAGGAGTGTTGATGG + Intronic
1134815714 16:17204064-17204086 CAGTGAGTGAGGACAGAGGTGGG + Intronic
1139842339 16:69891724-69891746 TAGTGAGTCAGGAGAGAACTGGG - Intronic
1142931344 17:3286426-3286448 TACTCAGTAAGGGGATTGGTGGG + Intergenic
1143074744 17:4331730-4331752 AACTGAGTAAGCAGAGTGGAGGG + Intronic
1143694303 17:8600011-8600033 TAGTCATTATGGAGAGTGGGAGG + Intronic
1145744023 17:27299850-27299872 TACTGAGTGGGTAGAGTGGTAGG + Intronic
1147336365 17:39728922-39728944 TTGTGAGTGAGGAGAGTGGTGGG + Intronic
1147448886 17:40491647-40491669 CACTGAGTAAGGAGAGCGGGAGG + Intronic
1148108231 17:45130724-45130746 GAGTGAGTGTGGAGAGTGGGGGG - Intronic
1148395662 17:47306143-47306165 GAGAGAGAAGGGAGAGTGGTGGG + Intronic
1148707466 17:49648353-49648375 TAGTGATAAGGGAGAGTGGTAGG - Intronic
1153814024 18:8777538-8777560 TAATGAAAAAGGAGAGTGGCTGG - Intronic
1154291833 18:13115416-13115438 CAGTGTGAAAGGGGAGTGGTGGG + Intronic
1155961424 18:31998716-31998738 TAGTGAGGAGGCAGAGTTGTGGG + Intergenic
1156598454 18:38575217-38575239 AAGAGAGCAAGGAGTGTGGTGGG + Intergenic
1156948521 18:42864926-42864948 TAGTAAGTAAGGCAGGTGGTTGG - Intronic
1157630754 18:49092960-49092982 CAGTGAATAAGGAGAGTTGAAGG + Intronic
1159700938 18:71625552-71625574 TAGTGACTTAGGAGATTGTTTGG + Intergenic
1160000191 18:75011012-75011034 CAGTGAGTAGGAAGGGTGGTGGG + Intronic
1162456536 19:10788387-10788409 GAGTGAGTGAGGGGAGTGGGAGG + Intronic
1163112954 19:15172474-15172496 GAGGGATGAAGGAGAGTGGTTGG - Intronic
1165821701 19:38680788-38680810 TCCTGAGTAAGGACAATGGTAGG - Intronic
1166052619 19:40269235-40269257 TAGGAAGTAATGAGTGTGGTGGG - Intronic
1167621457 19:50563263-50563285 AGGAGAGTAAGGAGAGTGGCAGG - Intronic
1168711389 19:58502126-58502148 TAGTGAGTGAGTAGATGGGTGGG + Intronic
1202635609 1_KI270706v1_random:41420-41442 TAGTGAGTGAGGTTGGTGGTGGG - Intergenic
925359133 2:3265257-3265279 TGCTGAGTAAGGAGTGTGCTTGG + Intronic
929070915 2:38029697-38029719 TAGGGAGCAGGGAGAGTGGAGGG + Intronic
929810399 2:45184812-45184834 GAGTGAGTAAGGAGAGAGATGGG - Intergenic
929929772 2:46244404-46244426 TAATAAGTAAAGAGGGTGGTAGG - Intergenic
930614498 2:53579266-53579288 ATTTGAGTAAGGAGAGTGCTCGG + Intronic
930781582 2:55229258-55229280 TAGAGAGTAAGGAAGGTGGGAGG + Intronic
931541501 2:63334582-63334604 TAGTGAGTAGAGTGAGTAGTAGG + Intronic
932971030 2:76542342-76542364 TACTCAGTAATGAGATTGGTGGG - Intergenic
935461796 2:103344708-103344730 TAGTAATTAAGGAGAGATGTTGG + Intergenic
935728220 2:106042706-106042728 TACTGAGTCATGAGAGTGGTTGG - Intergenic
939837354 2:147147174-147147196 TACCCAGTAAGGAGATTGGTGGG + Intergenic
940032136 2:149274697-149274719 CAGTGAGAAAGGAGTGTGATGGG + Intergenic
940774812 2:157875381-157875403 TAGAGAGTAAGGAGATAGATAGG - Intronic
945150378 2:206784380-206784402 TGGTTAGATAGGAGAGTGGTAGG + Intronic
945698091 2:213134327-213134349 TAGTGGGAAAGGAGATTGGAAGG - Intronic
945722009 2:213429103-213429125 AAAAGAGTAAGGAGAGAGGTGGG + Intronic
945763314 2:213942377-213942399 AAGTGAGTGGGGAGAGTGTTAGG - Intronic
946018922 2:216626223-216626245 TAGCCAGTAAGCAGAGTGGGTGG + Intergenic
946347690 2:219124458-219124480 TGGTGAGTAGAGAGTGTGGTTGG - Intronic
947029530 2:225777662-225777684 TGGTGAATAAGTGGAGTGGTAGG + Intergenic
1169200656 20:3707614-3707636 TAGTTAGTAAGGCAGGTGGTAGG - Intergenic
1170037695 20:12006010-12006032 CAGAGAGGAAGGAGAGGGGTTGG - Intergenic
1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG + Intergenic
1174105046 20:48155994-48156016 TAGAGAGTAATGAGAGTGGGTGG + Intergenic
1174758784 20:53186035-53186057 TAGTGAGAAAGGAGAGACATTGG - Intronic
1178005012 21:28208707-28208729 TAGAGAGGAAGGATAGTGGAAGG + Intergenic
1178348283 21:31850969-31850991 TAGGGGGCAAGGAGAGAGGTGGG - Intergenic
1180365102 22:11931806-11931828 TAGTGAGTGAGGTTGGTGGTGGG + Intergenic
1182064770 22:27422791-27422813 TAGGGAGTAAGTAGTGTGGATGG + Intergenic
1183451761 22:37899952-37899974 TGGTGGGTAGGGGGAGTGGTTGG - Intergenic
1183480891 22:38064975-38064997 GGGTGCATAAGGAGAGTGGTGGG - Intronic
1184108623 22:42382818-42382840 CAGTGAGCAAGGAGAGAGGCAGG - Exonic
950767174 3:15281489-15281511 TGGAGAGGAAGGAGAGAGGTAGG - Intronic
951945459 3:28130984-28131006 CAGTGAGTGAGGAGAGTGGTAGG - Intergenic
952056898 3:29457945-29457967 TACTTAGATAGGAGAGTGGTGGG - Intronic
952150492 3:30584028-30584050 AAGAGAGGAAGGGGAGTGGTAGG - Intergenic
957430832 3:80104215-80104237 GAGTGAGTAGGGAGAGTGAGAGG - Intergenic
957467422 3:80612186-80612208 GAGTGAGTTAGGAGAGGGATGGG - Intergenic
958271553 3:91506178-91506200 TAGATAGTAAAGAGAGTGATAGG - Intergenic
958841001 3:99205252-99205274 TAGTGTGTAAGGCTTGTGGTTGG + Intergenic
958843633 3:99239080-99239102 TAATGGCTAAGGAGAGTGGGGGG - Intergenic
960614778 3:119586444-119586466 AAGTGAGCATCGAGAGTGGTCGG + Exonic
961549271 3:127659462-127659484 TCTTTAGAAAGGAGAGTGGTGGG - Intronic
962237374 3:133718080-133718102 TGGTGGGAAGGGAGAGTGGTGGG + Intergenic
964006175 3:151831971-151831993 GAGTAAATAAGGAGAGTTGTAGG + Intergenic
964778292 3:160305264-160305286 CAGTGAGTAAGCAAACTGGTAGG + Intronic
964917026 3:161851599-161851621 GAGTGAGGAAGGAGAATGGGAGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
966233421 3:177673884-177673906 TATGGTGTAAGGATAGTGGTAGG + Intergenic
966457428 3:180133675-180133697 CAGTGAGAAAGGAGAGCGGAAGG - Intergenic
969490469 4:7496623-7496645 TAAAGAGAAAGGAGAGTGGCCGG + Intronic
969565117 4:7972713-7972735 TCGGGAGTCAGGAGAGTGGCAGG - Intronic
970745494 4:19289832-19289854 TAGTGAGTAATGGGATTGCTGGG + Intergenic
973638452 4:52880920-52880942 AAGTGAGTGAGGAGAGAGGCTGG + Intronic
974374163 4:61055202-61055224 TAGTGAGCAAGGAGAGTCTCTGG + Intergenic
975841209 4:78475952-78475974 GAGTGTGTAAGGAGACTGGTTGG + Intronic
977542840 4:98338997-98339019 GAGGGAGTAAGGAGAATGGGAGG - Intronic
979589005 4:122456468-122456490 TAGTGATTAAAGAGAGTGATAGG + Exonic
979610908 4:122687929-122687951 TGGTGAGTGATGAAAGTGGTGGG + Intergenic
981140032 4:141257408-141257430 TAGTGAGTAAGGAAGGGGCTAGG - Intergenic
983840471 4:172451536-172451558 TAGTGAGGAAGAAAAGAGGTTGG + Intronic
983966829 4:173823062-173823084 TCATGAGTAATGGGAGTGGTGGG + Intergenic
984491504 4:180440002-180440024 GAGGGAGTAAGGAGAGAGGGAGG - Intergenic
984499296 4:180537937-180537959 TGATGAGTAAGGAGGGTGCTGGG + Intergenic
984600830 4:181724914-181724936 CAGGGAGTAAGGAAAGTGATGGG + Intergenic
1202762931 4_GL000008v2_random:127300-127322 TAGTGAGTGAGGTTGGTGGTGGG - Intergenic
987039527 5:14048737-14048759 TAGTGGTGAAGAAGAGTGGTGGG - Intergenic
987086932 5:14479040-14479062 TGGTGTGTATGGAGAGTGATGGG + Intronic
988964057 5:36398282-36398304 AAGTGAGTCAGGAGACTTGTTGG + Intergenic
991140295 5:63232553-63232575 TAGTCAAGAAGCAGAGTGGTGGG + Intergenic
992703424 5:79363310-79363332 TAGCAAGGAAGGAGAGTGGAAGG - Intergenic
995900441 5:117059541-117059563 GAGTGAGGAAGGAAAGAGGTCGG + Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
997310096 5:132872664-132872686 TTCTGAGTAAGGAGACTGATTGG - Exonic
997410557 5:133687580-133687602 TAGTGAGTAGGAAGAATGGAAGG - Intergenic
999099007 5:149006819-149006841 GAGTCAGGAAGGAGAATGGTTGG + Intronic
999364525 5:151013432-151013454 TAGAAAGTATGGAGAGTGGCCGG + Intergenic
999365772 5:151022516-151022538 TTGGGGGTAAGGTGAGTGGTTGG - Intronic
999369677 5:151046243-151046265 TAGGGAGTGAGGAGAGTGGCTGG - Intronic
1000656931 5:163890529-163890551 TATTCAGTAAGGAAAGAGGTGGG - Intergenic
1001004881 5:168041429-168041451 TAGTGAGAAGGAGGAGTGGTGGG - Intronic
1004977255 6:20981868-20981890 TAGGAAGGAAGGAGAGTGATGGG - Intronic
1004989785 6:21124556-21124578 TAGTGGGTAAAGGGAGTGGGAGG - Intronic
1007732271 6:43954436-43954458 TAGGGAGTGGGGAGAGTGGCGGG - Intergenic
1008095590 6:47336400-47336422 GAGTGAGAAAGGAGATTGGCAGG - Intergenic
1008983565 6:57514916-57514938 TAGATAGTAAAGAGAGTGATAGG + Intronic
1009171619 6:60407810-60407832 TAGATAGTAAAGAGAGTGATAGG + Intergenic
1009614875 6:65991143-65991165 CACTGAGTAAGGAGTGTGATTGG + Intergenic
1009765220 6:68065020-68065042 GAGTGAGTCAGGGAAGTGGTTGG + Intergenic
1009831187 6:68937960-68937982 TAAAAAGTAAAGAGAGTGGTGGG + Intronic
1010988626 6:82454199-82454221 TACTGAGTAATGAGATTGCTGGG + Intergenic
1013611158 6:111796766-111796788 TCGTGGGTAAGGGGAGTGGCAGG + Intronic
1013659732 6:112282999-112283021 TAGCGGGTAAGGAAAGGGGTGGG - Intergenic
1015257057 6:131190291-131190313 TAGTGAATAATGAGAGCTGTTGG + Intronic
1015287076 6:131497863-131497885 TGGGGAGTAAGAAGGGTGGTGGG + Intergenic
1018052427 6:160022959-160022981 CGTTGAGTGAGGAGAGTGGTAGG + Intronic
1021275996 7:18651906-18651928 AAGTCAGAAAGGAGAGTGCTGGG + Intronic
1022305989 7:29146990-29147012 CAGTGATTCAGGAGAGTGCTTGG - Intronic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023598841 7:41861414-41861436 TAGGTAGTAAGGAAAGTGTTGGG + Intergenic
1024208084 7:47180866-47180888 TGGTGAGGACGGAGAGTGTTTGG - Intergenic
1025190141 7:56890122-56890144 TGGGGACTAAGCAGAGTGGTAGG + Intergenic
1025681797 7:63686798-63686820 TGGGGACTAAGCAGAGTGGTAGG - Intergenic
1026471751 7:70699865-70699887 TTGTGAGAAAGGAGGGTGATGGG + Intronic
1027854210 7:83488105-83488127 TAGAGAGTGAGAAGAGGGGTGGG + Intronic
1030234951 7:107248320-107248342 TAGGGAGTAAGCATAGAGGTGGG + Intronic
1030340803 7:108377651-108377673 TGGTGAGTAATGAGAGAGGATGG - Intronic
1031018587 7:116602106-116602128 GAGAGAGTAAGGAAAGTGGGAGG + Intergenic
1032541513 7:132706627-132706649 GAGACAGAAAGGAGAGTGGTAGG - Intronic
1033235886 7:139637368-139637390 TATTAAGCTAGGAGAGTGGTTGG - Intronic
1033259028 7:139826289-139826311 TACTGAAAAAGGAGAGGGGTGGG + Intronic
1033870035 7:145741937-145741959 CAGTGAATAATGAGAATGGTTGG + Intergenic
1033890699 7:146009324-146009346 TAGTGTGTAAGGAGAAGGATAGG + Intergenic
1034507950 7:151510119-151510141 GTGTGAGTAATGAGAGAGGTCGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1038254732 8:25941100-25941122 TCATGAGTATGGAGAGTGGAAGG + Intronic
1038485161 8:27929927-27929949 GTGTGAGGGAGGAGAGTGGTAGG - Intronic
1039763137 8:40599783-40599805 TGCTGTGTAAGGAGAGTGGTGGG + Intronic
1040508353 8:48071818-48071840 AAGTGAGTGGGGAGAGTGTTAGG - Intergenic
1045522468 8:102915203-102915225 AAGTGAGTAAGGGGAGCAGTTGG - Intronic
1047380499 8:124357762-124357784 TAGTAAGTAGGAAGAGAGGTTGG + Intronic
1048615909 8:136075415-136075437 TAGAGAGTATGCAGAGAGGTGGG - Intergenic
1048693869 8:137001861-137001883 TAGTGAGTGAGGACTGTTGTGGG + Intergenic
1050872249 9:10587480-10587502 TAATAAGTAAGGAGAGTTGCAGG + Intronic
1052947496 9:34179592-34179614 TAGTAAAGAAGGTGAGTGGTGGG + Intronic
1053144298 9:35701993-35702015 TAGGGAGAGAGGAGAGTGGCAGG + Intronic
1056856235 9:90131988-90132010 CAGTGAGGAAAGAGAGTGGAAGG - Intergenic
1058107419 9:100988549-100988571 TAGAGAGTAAAGAGAGAGGAGGG + Intergenic
1059291015 9:113223673-113223695 GAGGGAGTAAGGGGAGTGGAGGG - Intronic
1059845114 9:118266976-118266998 TAGTGGGCAAGTAGAGGGGTTGG + Intergenic
1060379628 9:123155054-123155076 TAGTGGGTAAGTAGAAAGGTCGG + Intronic
1060871307 9:127042808-127042830 AAGTGAGTAAGCAGAGTTGCAGG + Intronic
1062695783 9:137875686-137875708 GAGAGAGAAAGGAGAGTGGTGGG + Intergenic
1203543694 Un_KI270743v1:112181-112203 TAGTGAGTGAGGTTGGTGGTGGG - Intergenic
1189027151 X:37407707-37407729 TAGTTAGTAAGGACAGTAATGGG - Intronic
1192020216 X:67382313-67382335 TGGTGAGCCAGGAAAGTGGTAGG + Intergenic
1192499455 X:71640050-71640072 TGGTGATCAAGTAGAGTGGTGGG - Intergenic
1193983845 X:88216478-88216500 TGGAGACTCAGGAGAGTGGTTGG - Intergenic
1195345891 X:103950893-103950915 TAGTGGGAAAGGAGAGTGGCTGG + Intronic
1195377205 X:104239329-104239351 TATTGAGCAGGGGGAGTGGTGGG + Intergenic
1195532828 X:105976609-105976631 TGTTGAGGAAGGAGAGTGGGAGG - Intergenic
1195901371 X:109801135-109801157 TAGACAGTAAGGAGGGTGATGGG + Intergenic
1196326258 X:114407199-114407221 GAGTGAGTAAGGCTAGTGTTAGG - Intergenic
1198229738 X:134677620-134677642 TAGTGAGTAAGGAGAGTGGTAGG + Intronic
1198791319 X:140349931-140349953 CAGAGTGTGAGGAGAGTGGTAGG - Intergenic
1199313319 X:146347107-146347129 TAGTGAATAAGAGGAGAGGTGGG + Intergenic
1201621152 Y:15959837-15959859 TACTCAGTAATGAGATTGGTGGG - Intergenic