ID: 1198230016

View in Genome Browser
Species Human (GRCh38)
Location X:134680088-134680110
Sequence CTGAATCTTCAGAAGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198230010_1198230016 0 Left 1198230010 X:134680065-134680087 CCAGTTTCAAACATGCTACCACC 0: 1
1: 0
2: 0
3: 14
4: 262
Right 1198230016 X:134680088-134680110 CTGAATCTTCAGAAGGACATGGG 0: 1
1: 0
2: 0
3: 24
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198230016 Original CRISPR CTGAATCTTCAGAAGGACAT GGG Intronic
900356246 1:2266136-2266158 CAGAATCTTCTGAGAGACATAGG + Intronic
904410367 1:30321435-30321457 CAGAATCTGCAGGAGGACGTTGG + Intergenic
904881363 1:33699736-33699758 CTGAATCTACTAAAAGACATTGG - Intronic
905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG + Intergenic
905629723 1:39511853-39511875 CTGAAGCGTCACAAGGACCTGGG + Exonic
905668036 1:39774337-39774359 CTGAAGCGTCACAAGGACCTGGG - Exonic
906776575 1:48535154-48535176 GTGAATGTGCAGAAGGACTTAGG + Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
908853861 1:68400947-68400969 CTAAATATTGAGAAGGATATAGG + Intergenic
910737809 1:90481298-90481320 CTGAAGTTTCTGAAGAACATTGG - Intergenic
911899510 1:103485026-103485048 ATCGATCTTCAGCAGGACATTGG - Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912114660 1:106390498-106390520 ATATATCCTCAGAAGGACATAGG - Intergenic
912116006 1:106408994-106409016 CTCCATCTTCAGAAAGACCTTGG - Intergenic
913169963 1:116222778-116222800 CTGAGGCTGCAGAAGGACACTGG + Intergenic
917034828 1:170736678-170736700 CAGATTCTTCAGAAAGACTTTGG - Exonic
918295031 1:183148549-183148571 CTGAATATTCAGAAAGGAATTGG - Intergenic
920186986 1:204165889-204165911 CTGAATATTAAGAAGGGCATGGG - Intronic
920542420 1:206789341-206789363 CTGGATCCTCAGAAGGGCAGGGG - Intergenic
922818396 1:228467556-228467578 GTGAATCTTCAGAGGGCAATAGG - Intergenic
923790782 1:237109530-237109552 CTGAATCTCCCGAAGGGCCTCGG + Intronic
1063848927 10:10162533-10162555 CTAAATCTTGAGTAGGAGATGGG - Intergenic
1065314644 10:24451433-24451455 CTCAATCTTCAGGAGGAGGTGGG - Intronic
1069326659 10:67239250-67239272 CTGTGTCTTTAGATGGACATAGG - Intronic
1070526219 10:77298209-77298231 CTGAACCTTCAGAAATACCTGGG + Intronic
1071336772 10:84606794-84606816 CTGAGTCTGCAGAAGGCCCTGGG + Intergenic
1073835182 10:107433271-107433293 CTGAATTGTCATAAGGACAGTGG - Intergenic
1075434807 10:122429329-122429351 CTGAATCTTCAAAGTGTCATAGG + Intronic
1076406234 10:130214075-130214097 CAGAATTCTCAAAAGGACATGGG - Intergenic
1077781104 11:5330685-5330707 CTGATCCTTAAGAAGGTCATGGG - Intronic
1082319788 11:50788489-50788511 CAGAATCTGCAGGTGGACATTGG - Intergenic
1082550136 11:54386091-54386113 TAGAATCTTCAGGTGGACATTGG + Intergenic
1082553111 11:54525565-54525587 TAGAATCTTCAGGTGGACATTGG + Intergenic
1083171555 11:60926535-60926557 GTCAATCATCAGAAGGACAAAGG - Intronic
1085833299 11:79926155-79926177 GTGAATGTTCCCAAGGACATCGG + Intergenic
1086042667 11:82497820-82497842 CTGAATCTTGAAAAGGGGATAGG + Intergenic
1086947680 11:92859487-92859509 CTGAATGTTCAAAAGGAAATGGG - Intronic
1089367093 11:117927501-117927523 CTGGATCTTCAGAGGGATCTTGG - Intronic
1091270094 11:134303478-134303500 CTGTAACTCCAGAATGACATAGG - Intronic
1092623215 12:10296747-10296769 TTGAACCTTCAGAAGGCCAAGGG + Intergenic
1095451119 12:42331138-42331160 CTCAAACTTCAGATGAACATAGG - Intronic
1096906409 12:54940686-54940708 CTGAAGCTTCAGATGATCATTGG + Intergenic
1099149764 12:79095809-79095831 TTGAATCTTCAGAAGGAAGAGGG - Intronic
1100287992 12:93185701-93185723 CTGTGTCTTCAGAAAGAGATAGG + Intergenic
1100858510 12:98779616-98779638 CTAAATCTTAAGAAAGACTTTGG - Intronic
1101206706 12:102495668-102495690 CTGACTCTTCACAAGGAAAATGG + Intergenic
1103254681 12:119530987-119531009 CAGCACCTTCAGGAGGACATGGG - Exonic
1104258728 12:127163279-127163301 CTGGATGTTCATTAGGACATGGG + Intergenic
1105829981 13:24155620-24155642 CAGAATCTGCAGAAAGCCATTGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107015917 13:35707588-35707610 CTGAATTGTCATAAGGACAAAGG - Intergenic
1110368372 13:74713213-74713235 CTGAAGATTCAGAAGATCATTGG - Intergenic
1115469569 14:33754619-33754641 CTGAATTTCCAGAAAGACAGAGG + Intronic
1116099759 14:40418442-40418464 CTAAATAATCAGAACGACATTGG + Intergenic
1117973645 14:61276881-61276903 CTGAATCTTAATAATTACATAGG + Intronic
1119469439 14:74885203-74885225 CTGAAGCTTGAGAAAGACATGGG - Intronic
1122137441 14:99642880-99642902 CTGAATATTGACAAGGACATTGG - Intergenic
1125376384 15:39034410-39034432 CTTATTCTTCATAAGGACAATGG + Intergenic
1126894412 15:53242831-53242853 CTCAATCATCAGAGGTACATGGG - Intergenic
1130012649 15:80163551-80163573 CTTATTCTGCAGAAGGACATGGG - Intronic
1130263293 15:82376423-82376445 TGGAATCTTCACAAGGCCATGGG + Intergenic
1130592629 15:85225056-85225078 TGGAATCTTCACAAGGCCATGGG - Intergenic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1131022020 15:89106918-89106940 CTGAAAAATCAGAATGACATGGG + Intronic
1133412234 16:5578426-5578448 CTGAATCCCAAGAAGGACCTTGG + Intergenic
1135617255 16:23922101-23922123 CAGCATGTTTAGAAGGACATTGG + Intronic
1135626701 16:24001850-24001872 TTGACTCCTGAGAAGGACATTGG + Intronic
1137073461 16:35931204-35931226 CGGAATCTTCAAAGGGACACTGG - Intergenic
1137553969 16:49458664-49458686 CTGAATAGTGAGAAGGACAGGGG + Intergenic
1138443441 16:57048480-57048502 TTGAACCTGGAGAAGGACATGGG - Intronic
1141103211 16:81212913-81212935 CTGAATCTTCAAAGGGTCTTTGG + Intergenic
1141544919 16:84760053-84760075 CTGAATGTTGAGAATGGCATAGG - Intronic
1143130855 17:4676080-4676102 CCGAAGCTGGAGAAGGACATGGG + Exonic
1144301965 17:13929354-13929376 TTGAATCTTCACAAGGAAAATGG + Intergenic
1144621376 17:16820696-16820718 GTCAATCTGCAGAAGGACATTGG + Intergenic
1146574944 17:33982670-33982692 CTGAATCTTCAAAGGTAGATAGG - Intronic
1147343257 17:39768234-39768256 CAGAAACTTCAGAAGTACTTGGG + Intronic
1147573353 17:41585010-41585032 GTCAATCTGCAGAAGGACATTGG + Exonic
1147777431 17:42912422-42912444 CTGGATCTTCAGAAGGCTAGAGG + Exonic
1149268347 17:54951879-54951901 CTGACTCTCCACAAGGACACAGG + Intronic
1154378515 18:13828657-13828679 CTGAAGCTGCTGTAGGACATGGG - Intergenic
1156025876 18:32654834-32654856 CCAAATATTCAGAAGGACTTGGG + Intergenic
1156357776 18:36357453-36357475 CTGAATCTTAACAAGGACCTTGG - Intronic
1159622362 18:70653051-70653073 CTTAAACATCAGTAGGACATGGG + Intergenic
1160185469 18:76673407-76673429 CGGAACCTTCAGAAGGAGATGGG - Intergenic
1160611198 18:80086726-80086748 CTGAATCTTGAAAAAGAAATAGG - Intronic
1163716350 19:18874638-18874660 CTGAGTCATGACAAGGACATGGG + Intronic
1163814603 19:19456789-19456811 CTGAAGATTCCAAAGGACATGGG - Intronic
1165177717 19:33942287-33942309 CTGCCTCCTTAGAAGGACATGGG + Intergenic
1166755711 19:45189794-45189816 CCAAATCTACAGAAGGATATCGG - Intronic
926646044 2:15290754-15290776 ATGAACCTCCAGAAGGACAGAGG + Intronic
929646215 2:43631243-43631265 CTGTTTCTTCAGAAGGATATAGG + Intergenic
930725847 2:54680690-54680712 CAGAATCTCCAGGAGGACAAGGG + Intergenic
931131979 2:59346287-59346309 ATGCATCTCCAGAAGGGCATAGG - Intergenic
931448646 2:62348743-62348765 GTGAATCTTCAGAGGGCCAAGGG + Intergenic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
935806766 2:106756661-106756683 CAGAGTCTTCAGAAGGACAGCGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939654155 2:144801968-144801990 CAGAATTGTCAGAAGGACAGAGG + Intergenic
941304167 2:163840872-163840894 CTGGATCATGAGAAGGACAGCGG + Intergenic
942832778 2:180256286-180256308 CTGAATGTCAAAAAGGACATGGG - Intergenic
943181836 2:184554372-184554394 CTGAATATTCAGAGTGAAATTGG + Intergenic
943838859 2:192552128-192552150 CTGCCTTTTCAGAAGGACATAGG + Intergenic
944637645 2:201690274-201690296 ATAAATCTGCAGAAGGACAAGGG + Exonic
945457790 2:210069248-210069270 GTGAAGTTTCAGAAGGAAATGGG - Intronic
945862904 2:215144233-215144255 CTGCAGCATCAGAAGGTCATTGG + Intergenic
946571101 2:221025198-221025220 CTGATTCTTTAGAATGAAATGGG - Intergenic
948182386 2:235992464-235992486 CTGAATCCTCAGAAAGGAATGGG - Intronic
1169628444 20:7598457-7598479 CTAAATATTCAAAAGGACTTGGG - Intergenic
1170534297 20:17324808-17324830 CAGCATCTGCAGAAGGAAATGGG + Intronic
1170868631 20:20184053-20184075 ATAAATGTTCAGTAGGACATGGG - Intronic
1172232366 20:33345550-33345572 CTGACTTTTCAGACAGACATTGG + Intergenic
1175356894 20:58375615-58375637 CTGACTAGTCAGAAGGACAGTGG + Intergenic
1178667196 21:34558691-34558713 CGGCATCTTCAAAAGGACACTGG + Intronic
1179900921 21:44393837-44393859 CTGACTCTTGAGAAAGACATGGG + Intronic
1180761469 22:18211792-18211814 ATGTATGTTCTGAAGGACATTGG - Intergenic
1180774198 22:18412818-18412840 ATGTATGTTCTGAAGGACATTGG + Intergenic
1181070309 22:20331825-20331847 ATGTATGTTCTGAAGGACATTGG + Intergenic
1181193300 22:21159770-21159792 ATGTATGTTCTGAAGGACATTGG + Intergenic
1181216144 22:21332830-21332852 ATGTATGTTCTGAAGGACATTGG - Intergenic
1183065000 22:35356680-35356702 CGGAACCTTCAGGAGGACTTTGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
951941764 3:28087204-28087226 CTGAAACTTGAGAAAGTCATTGG + Intergenic
952447569 3:33397216-33397238 CTGATTATTTTGAAGGACATTGG - Intronic
953295531 3:41711747-41711769 ATGCATTTTCAAAAGGACATAGG + Intronic
954093437 3:48302837-48302859 CTGAATCTGCAGTAGGCCAAAGG + Intergenic
954357048 3:50090416-50090438 CTAAATCTTCAGTGGGACAATGG + Exonic
956668278 3:71662510-71662532 CTGAATTTTCATTAGAACATGGG + Intergenic
958797817 3:98724807-98724829 CTGAATGTTCAGCAGGCAATTGG + Intergenic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
960020598 3:112947925-112947947 CTGAATTTTGAAAAAGACATAGG + Intronic
961920687 3:130422708-130422730 CTGAATCTTCAGGGTGATATTGG + Exonic
962481624 3:135803018-135803040 CTGACTCTGAAGAAGGGCATGGG + Intergenic
964540428 3:157773556-157773578 CTGGGCCTTCAGGAGGACATGGG + Intergenic
965873106 3:173284366-173284388 CTCACTCTTGAGAAGTACATGGG + Intergenic
967728159 3:192881310-192881332 GTGAATCACCAGGAGGACATAGG + Intronic
968861207 4:3171782-3171804 TTGATTCTTGAAAAGGACATTGG + Intronic
969445837 4:7244320-7244342 ATGAATCTTCGGAATGACTTTGG - Intronic
970438631 4:16060166-16060188 CTGAAAATTCAGAAGTACAAAGG - Intronic
971449607 4:26787717-26787739 CTGAAGGTTCAGAAGGAAGTAGG + Intergenic
973804082 4:54508454-54508476 CTTAAGCTTCATAAGGAAATTGG - Intergenic
975822272 4:78284029-78284051 TTGAAGCTTAAGAAGAACATCGG + Intronic
976012662 4:80510099-80510121 CTGAATCCTCAAAATGATATGGG + Intronic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
979421133 4:120506579-120506601 CTTAAGCTTCAGAAGCAGATGGG - Intergenic
979970487 4:127128533-127128555 CTTAATCTTCAGATGAAAATTGG - Intergenic
981341125 4:143622805-143622827 CTGAATCTTGAAAAGTAAATGGG - Intronic
981812239 4:148789223-148789245 CTGTATCTTGAGAAAGACATGGG - Intergenic
983612819 4:169668835-169668857 CTGAAGCTTCAAGAGGACTTAGG - Intronic
984029123 4:174581523-174581545 CTGAAGCTTGAGAAGGAGAGAGG - Intergenic
984549992 4:181148251-181148273 CAGAATCTTCAAAACTACATGGG - Intergenic
986399061 5:7361694-7361716 CTTCATTTTCAGAAGGACTTAGG - Intergenic
987819634 5:22946331-22946353 CTGAATCTACAGAGGAACTTGGG + Intergenic
988048312 5:25989303-25989325 CTGATTCTTCTGAAGGATCTGGG + Intergenic
990076614 5:51853281-51853303 CTCAAGGTTCAGGAGGACATAGG + Intergenic
991980482 5:72225363-72225385 GTGAGTCCTGAGAAGGACATTGG - Intronic
996714120 5:126572868-126572890 CTGTGTATTCAGAAGGATATAGG - Intronic
997033121 5:130155033-130155055 TTGAATCTTCAGTAGGAATTTGG + Intronic
999353196 5:150897425-150897447 CTGAATCTGTAGCAGGATATTGG - Intronic
999910185 5:156189054-156189076 GTGAATCTTCAGAGGGCCAGGGG + Intronic
1000270394 5:159678434-159678456 CTGAAATGTGAGAAGGACATGGG - Intergenic
1000353983 5:160375585-160375607 CTGAATCTTCAGAATATCAAAGG + Intergenic
1004323716 6:14654324-14654346 CTGAAGCTTCAGAAATACATAGG - Intergenic
1006343384 6:33459927-33459949 CTGCATCTTCTGAAGGACAGAGG - Intergenic
1007206395 6:40155246-40155268 CTAAATCTGAAGAATGACATTGG + Intergenic
1008826383 6:55699388-55699410 CTGAATCTATAGAAGGACTGAGG + Intergenic
1009269309 6:61598343-61598365 CTGAATCTTGGGAAAGGCATTGG - Intergenic
1012860586 6:104554848-104554870 CTGAATTTTTAGAAGCACATTGG + Intergenic
1012902473 6:105022261-105022283 GTGAATCTTCAGAAGGCAAAGGG - Intronic
1014928527 6:127304385-127304407 CTAGATATTCAGAAGGACGTAGG - Intronic
1015147134 6:129999888-129999910 TTGTATCTTCAGAAGGAAAAGGG + Intergenic
1016290891 6:142527111-142527133 CCCATTCTTCAGAAGGAGATGGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018202790 6:161410818-161410840 TTGAATCCTCAGAATGATATGGG + Intronic
1021085135 7:16413819-16413841 CTAAATCTTCAGATTGAGATTGG - Intronic
1021105242 7:16630970-16630992 CTCAATCTTCAGGAACACATAGG + Intronic
1022499574 7:30874030-30874052 CTGAATCGTTAAAATGACATCGG - Intronic
1023996853 7:45163824-45163846 GTCAAGCTTCAGAAGGACACGGG + Intronic
1024754668 7:52515861-52515883 CTGAAGCTTCTGCAGAACATAGG - Intergenic
1025111339 7:56218840-56218862 CTGAAATTTGAGAAGGACACTGG - Intergenic
1026306568 7:69147621-69147643 CTGAAATTTAAGAAGGACACTGG + Intergenic
1028664795 7:93329051-93329073 CAGAATCTCCAGAATGAAATTGG + Intronic
1029307633 7:99632115-99632137 CTTAAGCTTCAGAAGGAGCTGGG + Exonic
1030826058 7:114159749-114159771 GTGAACCTTCAGAAGGCCAAGGG - Intronic
1031571997 7:123370428-123370450 CTTAATCTTAAAAAGCACATAGG + Intergenic
1032621827 7:133542089-133542111 GTGAATCTTCAGAAGGCCAAGGG - Intronic
1032807362 7:135369691-135369713 GTGCATTTTTAGAAGGACATAGG + Intronic
1035548911 8:504911-504933 ATGTATCTTAAAAAGGACATAGG - Intronic
1036408930 8:8480200-8480222 CTCCTTCATCAGAAGGACATTGG + Intergenic
1036929345 8:12939093-12939115 CTGAATCTTCAGAAGTTTAGGGG + Intergenic
1039229456 8:35427277-35427299 CTGAATGTTCACATGCACATAGG + Intronic
1039254205 8:35701215-35701237 CTGAATCTTAAAAATGACATAGG + Intronic
1040750573 8:50701357-50701379 CTGAAGCTAGGGAAGGACATGGG - Intronic
1041130280 8:54691703-54691725 GTGAATCTTCACAAGGAAAAGGG - Intergenic
1041861747 8:62521714-62521736 ATGAATCTTCAGAAGTAAATGGG - Intronic
1043109222 8:76157389-76157411 TAGAATCTTCAGAAGGAATTCGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043813122 8:84767518-84767540 TTGAAACTTCAGAATGAGATGGG + Intronic
1051241773 9:15064462-15064484 CTGAACCTTCAAGAGGACATAGG + Intergenic
1051776214 9:20637059-20637081 CAGAATCTTCAGAAAGGCAGAGG + Intergenic
1052208210 9:25869440-25869462 TTGAAATATCAGAAGGACATGGG - Intergenic
1053224311 9:36339764-36339786 CTGATGCTTCAGAAGTGCATCGG - Exonic
1053349710 9:37405158-37405180 GTGAACCTTCAGAAGGAAAAGGG - Intergenic
1055355545 9:75433618-75433640 CTGAACCTCAAGGAGGACATGGG + Intergenic
1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG + Intergenic
1057806895 9:98225921-98225943 CTCAAACTTCAGGAGGACATGGG - Intronic
1060885996 9:127152801-127152823 CTGAAGCTTTAGGAGGAGATGGG - Intronic
1186780869 X:12910797-12910819 CAGAATCTGCAGAAGAAAATTGG + Intronic
1187268329 X:17757372-17757394 CTGAATCTTCAGAATGGAAATGG - Intergenic
1187320908 X:18236904-18236926 CTGAATCTTCAGAATGGAAGTGG + Intergenic
1190097943 X:47497470-47497492 CTGAACTTTCAGAAGGAGGTGGG - Intergenic
1192239508 X:69318256-69318278 TTGAATCTTCACAAGGACCTTGG + Intergenic
1194701713 X:97121401-97121423 CTGAGTCTTGTGAAGGACAAAGG - Intronic
1195433480 X:104815509-104815531 TTATATCTTCAGAAGGTCATTGG - Intronic
1195832892 X:109079063-109079085 CTGTATCTTCATAAGGATGTGGG - Intergenic
1198230016 X:134680088-134680110 CTGAATCTTCAGAAGGACATGGG + Intronic
1198488799 X:137116811-137116833 CCAAATCTTCAGAGGGTCATAGG - Intergenic
1198703731 X:139424369-139424391 CAGCAGCTTCAGAAGGACATTGG + Intergenic
1199835753 X:151588905-151588927 ATGAATCTTCAGCAGGCAATGGG - Intronic
1200391721 X:155952332-155952354 ATGAATGTTTTGAAGGACATTGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic