ID: 1198231236

View in Genome Browser
Species Human (GRCh38)
Location X:134691637-134691659
Sequence TTTCCAGAAGGGCCGTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198231236_1198231239 -8 Left 1198231236 X:134691637-134691659 CCTTAGGACGGCCCTTCTGGAAA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1198231239 X:134691652-134691674 TCTGGAAATGTAAACACACCTGG 0: 1
1: 0
2: 0
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198231236 Original CRISPR TTTCCAGAAGGGCCGTCCTA AGG (reversed) Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
912734263 1:112136025-112136047 TTGCCAGAAGTCCCTTCCTAGGG - Intergenic
915964464 1:160294347-160294369 TTCCCAGAAGGGCTGACCTTAGG + Intronic
917302997 1:173598153-173598175 TATCTACAAGGGCAGTCCTAAGG + Intronic
920071720 1:203307124-203307146 TTTCCCGAAAAGCCGTCCAAGGG + Exonic
920350511 1:205335124-205335146 TTTCCAGAATGGACTTCCAAGGG + Intergenic
922011455 1:221592839-221592861 TTTCCAGTAAGCCCTTCCTAGGG + Intergenic
923832662 1:237575104-237575126 TTGCCAGCAGGGCAGTCCCAAGG + Intronic
1062952604 10:1516052-1516074 TTGACAGTAGGGCCGTCCTCTGG - Intronic
1063283845 10:4661692-4661714 CTTGCAGAAGAGCCGTCCTCTGG + Intergenic
1063873786 10:10449863-10449885 TTTCTAGAAAGGCTCTCCTATGG - Intergenic
1067465599 10:46496433-46496455 TTTCCAGAAGTGGCATCCAAGGG - Intergenic
1067621588 10:47888172-47888194 TTTCCAGAAGTGGCATCCAAGGG + Intergenic
1069982408 10:72261421-72261443 TTCCCAGAGTGGCCTTCCTATGG + Intergenic
1070864711 10:79700841-79700863 TCTCCAGCGGGGCCCTCCTAGGG - Intergenic
1070878497 10:79838969-79838991 TCTCCAGCGGGGCCCTCCTAGGG - Intergenic
1071522805 10:86341423-86341445 TTTCCAGAAGGGCCCGCTTAGGG + Intronic
1071631610 10:87223059-87223081 TCTCCAGCGGGGCCCTCCTAGGG - Intergenic
1071645054 10:87355279-87355301 TCTCCAGCGGGGCCCTCCTAGGG - Intergenic
1072948810 10:99834889-99834911 GTTCCAGAAGAGCCATGCTATGG + Intronic
1076869488 10:133186368-133186390 TGTCCAGAAAGGCCTTCCTGGGG - Exonic
1082216917 11:49582560-49582582 TTTCCAGAAGGAACAGCCTATGG + Intergenic
1084590123 11:70085556-70085578 TTTCCAGGAGAGGCATCCTAGGG + Intronic
1085449172 11:76621809-76621831 CTTCCAACAGGGCCGTGCTAAGG + Intergenic
1088841460 11:113630711-113630733 TGACCAGAAGGCCCATCCTAGGG - Intergenic
1091622174 12:2097576-2097598 TTTCGATAATAGCCGTCCTAAGG + Intronic
1093693312 12:22132083-22132105 TTTCCAGAAGAGCAGGCATAGGG - Intronic
1105545429 13:21347510-21347532 GTGCCTGAAGGTCCGTCCTAAGG + Intergenic
1114363270 14:21999601-21999623 TTTCCAGAAGCTCCGCCCAATGG + Intergenic
1114636873 14:24192535-24192557 TATCCAGAGGGGCAGACCTAAGG - Intronic
1119755765 14:77118155-77118177 TTTGCAAACAGGCCGTCCTAAGG - Intronic
1121107115 14:91288285-91288307 TTTCCCTAAGGGCTGTCCTTTGG - Intronic
1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG + Exonic
1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG + Intronic
1132088182 15:98924800-98924822 CTTCCAGAAGGGTCATGCTAAGG + Intronic
1141504121 16:84463420-84463442 GTTCCAGAAGGGCCTGCCTGTGG - Intronic
1151316455 17:73325417-73325439 GTCCCAGAGGGGCCGTCCTGGGG + Intergenic
1167569221 19:50276535-50276557 TTTCCAAAAGGCCCTTCCTCAGG - Intronic
928469074 2:31555547-31555569 GTTTCAGAAAGGCCGTCCTTAGG - Intronic
936045758 2:109186649-109186671 TTTCCCGCAGGGTCTTCCTAGGG - Intronic
938977977 2:136497361-136497383 TTTCCTGAAGGGCCATACTCCGG - Intergenic
941168428 2:162108572-162108594 TTTCCCAAAGGGCTGTCCTCTGG + Intergenic
943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG + Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1169757945 20:9063659-9063681 ATTCCAGAAGGACCTTCCAAGGG + Intergenic
1175269054 20:57720978-57721000 GTTACTGAAGGGCCGTTCTATGG - Intergenic
1177907463 21:26989482-26989504 TTTCCTGATGGCCCGCCCTATGG - Intergenic
1180157383 21:45984106-45984128 CTTCCAGGAGGGCCGGCCTCAGG + Intronic
1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG + Intronic
1184737274 22:46406648-46406670 TTTCTAGATGGGCTGTCCTTAGG + Intronic
950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG + Intergenic
951170608 3:19537541-19537563 TTTCCAGAAGGGCTGTGCATTGG + Intergenic
955380533 3:58434557-58434579 TTTAGAGAAGGGCGGCCCTATGG + Intergenic
967299251 3:187996379-187996401 TTTCTAGAAGAGCTGTCCTCTGG + Intergenic
967917986 3:194592995-194593017 CTTCCAGGAGGGACTTCCTATGG - Intronic
974722025 4:65752586-65752608 TTTCCTGATGGCCTGTCCTACGG + Intergenic
984019113 4:174463233-174463255 TTGCCACAAGGGCCCTCTTAGGG + Intergenic
984194444 4:176641968-176641990 TTCCCAGAAGTGAAGTCCTATGG - Intergenic
984279196 4:177647847-177647869 TTTCCAGTAGGGTCTTGCTATGG - Intergenic
991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG + Intergenic
999366787 5:151028662-151028684 CTTCCTGAAGGGCCCTCCCAAGG + Exonic
1003406193 6:5828977-5828999 ATGCCTGAAGGTCCGTCCTAAGG - Intergenic
1019332018 7:464911-464933 TTTCCAGCAGATCCGTCCTCAGG + Intergenic
1020156404 7:5728200-5728222 TCTCCAGAAGGGCCACCCTGAGG - Intronic
1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG + Intronic
1035034202 7:155884705-155884727 TATCAAGAGGGGCTGTCCTAAGG + Intergenic
1036088987 8:5644550-5644572 TTTCCAGGAGGGCCGAACAAAGG - Intergenic
1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG + Intronic
1041193601 8:55377829-55377851 TTTCCAGAAGTGCCTTTCTGGGG - Intronic
1042749214 8:72139884-72139906 CTGCCAGAAGGGCAGTACTAGGG - Intergenic
1050326919 9:4506882-4506904 TTTCCATGAGGGCAGTACTAAGG + Intronic
1059567055 9:115393464-115393486 TTTCCAGAAGGTCAGTCCTCAGG + Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic