ID: 1198231239

View in Genome Browser
Species Human (GRCh38)
Location X:134691652-134691674
Sequence TCTGGAAATGTAAACACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198231236_1198231239 -8 Left 1198231236 X:134691637-134691659 CCTTAGGACGGCCCTTCTGGAAA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1198231239 X:134691652-134691674 TCTGGAAATGTAAACACACCTGG 0: 1
1: 0
2: 0
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198231239 Original CRISPR TCTGGAAATGTAAACACACC TGG Intronic
902677820 1:18021071-18021093 CCAGGAAATGCAAACCCACCTGG - Intergenic
902832829 1:19028778-19028800 TCTGGACAGTTCAACACACCGGG - Intergenic
907041580 1:51265603-51265625 TCTTGAAATTTAAACTCACAGGG + Intronic
908456199 1:64307263-64307285 TCTGAGAATGTAAATACACCAGG - Intergenic
910052381 1:82990530-82990552 TCTGGAAGCGTAACCACACTGGG - Intergenic
915621787 1:157090679-157090701 TCTGGAAATGTAAGTCCTCCGGG + Intergenic
916946400 1:169732894-169732916 TCAGCAAAGGTACACACACCTGG - Exonic
917430128 1:174957828-174957850 TCCTGAAATGAAAACATACCTGG - Intronic
918068996 1:181121299-181121321 TCTGGAAATGCTAACACAAAGGG - Intergenic
918374439 1:183894975-183894997 TCTGGAAATTTCAAGACATCAGG + Intronic
918392294 1:184079022-184079044 TCTGCACATGTAAACACTCAAGG - Intergenic
921393216 1:214638583-214638605 TCTAGATATGCAAACACCCCAGG - Intronic
923015541 1:230123918-230123940 TCTAAAAATGTGAAAACACCTGG + Intronic
923669615 1:236029429-236029451 TCTGGAGAGGGAAATACACCGGG - Intronic
1064178243 10:13094222-13094244 TCTTGAAAAGTAAACTCACTGGG - Intronic
1065129303 10:22604512-22604534 TTTGGAAAAATAAACACAGCAGG + Intronic
1065971668 10:30810579-30810601 TCTGGAAATGCAGACCCCCCAGG + Intergenic
1067513324 10:46913365-46913387 TGTGTACATGTAAACACAACAGG - Intronic
1067648928 10:48138477-48138499 TGTGTACATGTAAACACAACAGG + Intergenic
1067881172 10:50046594-50046616 TGTGGAAATGTGAGCACAGCTGG + Intergenic
1069749790 10:70737722-70737744 TCTGGAACTTTGAAAACACCTGG - Intronic
1070055514 10:72930702-72930724 TCTTGGAATGTCAACACACTGGG - Intronic
1070500344 10:77066803-77066825 TCTGGCAAAGTAAACCCACATGG - Intronic
1071520358 10:86328231-86328253 TCTCTAAATGTAAACACAGAGGG + Intronic
1071700632 10:87929886-87929908 TCTGAAAATGGAAACATACTTGG - Intronic
1073856713 10:107684142-107684164 TAAGGAAATAGAAACACACCAGG + Intergenic
1074176733 10:111013703-111013725 TCTTAATATATAAACACACCTGG - Intergenic
1075789935 10:125076830-125076852 TCTGGACATTTAAACTCTCCAGG - Intronic
1079663511 11:23073213-23073235 TGTGGAAATGTAAATACAATGGG - Intergenic
1083031023 11:59592482-59592504 CCTGGAAATGGAAAGCCACCAGG + Intronic
1084860740 11:72016318-72016340 TCTGGAAATGGAGGAACACCAGG + Intronic
1085980073 11:81714228-81714250 TATGGAAATCTAAAGACAACAGG - Intergenic
1086016813 11:82178208-82178230 TCTGGAAATGTAAAATAATCTGG + Intergenic
1086067394 11:82760718-82760740 CCTGGAAATGGAAAAATACCAGG + Intergenic
1086384607 11:86294212-86294234 GCTGGATAAGTAAAGACACCTGG - Intergenic
1086606876 11:88706247-88706269 TCTGGGAATGGTAACACAACTGG - Intronic
1087189847 11:95242042-95242064 ACTGGAAGTGGAAACACACCAGG - Intergenic
1087328532 11:96752637-96752659 TCTAGAAATGGAAACATTCCTGG - Intergenic
1088732418 11:112694872-112694894 CCTGGAATTGTAAACACATAAGG + Intergenic
1091165353 11:133470816-133470838 TCTGGAAATGCAGACAAACATGG - Intronic
1092101229 12:5885180-5885202 TCTGGAAGTATAAACACACTGGG + Intronic
1097653013 12:62326455-62326477 TCTGTATATTTAAACACAACTGG - Intronic
1099782205 12:87210373-87210395 TCTGTAAATGTAAAGGCACAAGG + Intergenic
1100045083 12:90369998-90370020 TCTGGAAATTTAACCACATTTGG - Intergenic
1100204319 12:92331539-92331561 CCTGGAAAAGTAAACAGAGCTGG - Intergenic
1100537317 12:95523220-95523242 TCTGGAAAATTAATCAAACCAGG + Intronic
1101025617 12:100602378-100602400 TCTGGAAATTTACACACAGTTGG + Intronic
1101314467 12:103616537-103616559 CCTGAAAATGTAAAAATACCTGG + Intronic
1101682245 12:106980589-106980611 TCTGGTAATGAAAATACATCTGG + Intronic
1101946805 12:109143565-109143587 TCTGAAAATGCACACATACCGGG - Intronic
1101989160 12:109470164-109470186 TAAGGAAATGTAAAGAGACCTGG - Intronic
1101992904 12:109501871-109501893 TCAGGAATTGGAAACAAACCTGG - Intronic
1105671572 13:22623485-22623507 TAGGGAAATGTAAATACAGCAGG - Intergenic
1106923003 13:34584637-34584659 TCTGGAAATGCAAAGACAAATGG - Intergenic
1108864008 13:54899766-54899788 TCTGGAAATGGAAACACTATGGG - Intergenic
1112134841 13:96565638-96565660 TCCTGAATAGTAAACACACCTGG - Intronic
1119083249 14:71716787-71716809 GCTGGGAATGTAAAATCACCAGG + Intronic
1119802911 14:77461317-77461339 TCAGGAATTGGAGACACACCTGG + Intronic
1120325982 14:83026798-83026820 TCTTAAAAGGAAAACACACCAGG + Intergenic
1122424913 14:101600349-101600371 CCTAGAAATGTTCACACACCTGG - Intergenic
1124362636 15:29049317-29049339 TCAGAAAGTGTAAACACACAAGG - Intronic
1125098055 15:35877333-35877355 TATGGAAATGTAAAGAGAACAGG - Intergenic
1127106983 15:55626989-55627011 TCTAGCAATGGAAACACACCTGG + Exonic
1127393081 15:58522437-58522459 TCTGGATTTGAAAACACCCCAGG - Intronic
1127871329 15:63076315-63076337 TCTGGAGTTGAAAACAGACCAGG - Intergenic
1128672031 15:69580920-69580942 TCAGAGAAGGTAAACACACCAGG + Intergenic
1129947415 15:79551322-79551344 ATTGGAAATGGAAAAACACCTGG + Intergenic
1130043286 15:80424159-80424181 TCTGGGCATGTATACACCCCAGG + Intronic
1131847736 15:96505728-96505750 TCTGCTAATGTAACCACACTGGG + Intergenic
1135797355 16:25458202-25458224 TCTAGAAATGTAAAAACAAAAGG - Intergenic
1135853427 16:25985060-25985082 ACTGGAAATGTAAACTCAGTAGG - Intronic
1136082098 16:27859011-27859033 TCTGAAACTGTGAACACACTTGG - Intronic
1136945273 16:34643043-34643065 TCTAGAAATGTAAACGTGCCAGG + Intergenic
1136948211 16:34682190-34682212 TTTAGAAATGTAAACATGCCAGG + Intergenic
1138867209 16:60836524-60836546 TCTAGATATGTCAACACACCGGG + Intergenic
1139218561 16:65154601-65154623 TCTGTAAATGTAGGCACACAAGG - Intergenic
1140405983 16:74711926-74711948 TCCGCAAGTGTAAACACACATGG - Intergenic
1141814893 16:86402989-86403011 TCTGGATATGTAATCTCACTTGG - Intergenic
1143858801 17:9872878-9872900 TCTAGAAGGGTAAACATACCCGG + Intronic
1144236633 17:13267962-13267984 TCTGGAAATACAAACAGACTTGG - Intergenic
1147862728 17:43533131-43533153 TCAGGAATTGAAAAAACACCTGG + Intronic
1148318544 17:46727391-46727413 TATTGAAATGGAAACCCACCTGG + Intronic
1148580292 17:48738792-48738814 TCTGCGTGTGTAAACACACCTGG + Intergenic
1148590924 17:48816500-48816522 ACTGGAAATGAAAGAACACCAGG + Intronic
1149169764 17:53795104-53795126 TCTGGAAATGTTGCCACAACTGG + Intergenic
1149542358 17:57477237-57477259 TCTGGAGAGGTAAACACAGCAGG + Intronic
1149900990 17:60478455-60478477 TATGGAAATGTAAACAAAGCAGG + Intronic
1151075598 17:71268710-71268732 ACTGGAAATAGAAACTCACCTGG - Intergenic
1152272216 17:79331354-79331376 TCTGGTAATGTGAACAGAACGGG - Intronic
1153524953 18:5986025-5986047 TCTGGAAATGAAAAGTGACCTGG + Intronic
1155086022 18:22458798-22458820 TCTGGAACTGTGATCACACAAGG - Intergenic
1157759577 18:50251067-50251089 TCTGGAAATACACACACACCTGG + Intronic
1157807810 18:50671252-50671274 ACTGGAAAGCTACACACACCAGG + Intronic
1157958670 18:52127710-52127732 TTTGCAAATGCAAACACATCTGG + Intergenic
1158149855 18:54356347-54356369 TCAGGAAAGGTAAAGAAACCAGG - Exonic
1158859361 18:61577361-61577383 TCTGAAAATGCAAACACCCTGGG + Intergenic
1160323678 18:77920067-77920089 TCTACAAATGTTTACACACCCGG + Intergenic
1166022740 19:40047431-40047453 TCTAGTAATGTAATCACATCTGG + Exonic
1166581109 19:43900849-43900871 TGAGGAAATATAAACTCACCTGG + Intronic
925144784 2:1573981-1574003 TGTGGAAAGGTACAAACACCAGG + Intergenic
925273914 2:2635694-2635716 TCTTGTTATGAAAACACACCGGG - Intergenic
925911022 2:8573732-8573754 TTGGGAAATGCAAAAACACCAGG - Intergenic
925964773 2:9053832-9053854 TCTGTATTTGTAAACCCACCCGG - Intergenic
926441950 2:12898503-12898525 TCATGAAGTGTCAACACACCTGG + Intergenic
928457225 2:31433284-31433306 ACTGTAAATGTAAACACAGAGGG + Intergenic
929141624 2:38671557-38671579 TCTCGAATTGTAATCCCACCTGG - Intronic
929213947 2:39390787-39390809 ACTGGAAATGAAAATACAACAGG + Intronic
931912698 2:66918990-66919012 TCTGCAACTGTAGTCACACCAGG - Intergenic
932789295 2:74639704-74639726 CTTTGAAATGTAAACACACAAGG - Intronic
933302859 2:80562068-80562090 TTTTGAAATGTAAACATATCTGG + Intronic
934802087 2:97174219-97174241 CCAGGAAATGTAAAAACATCAGG + Intronic
934833721 2:97562059-97562081 CCAGGAAATGTAAAAACATCAGG - Intronic
935074237 2:99724911-99724933 TCTGGAAATATAAAAACAATGGG - Intronic
938258931 2:129881512-129881534 TCTGCAAATGAAATCACACTGGG - Intergenic
939010580 2:136841298-136841320 TATGGAAATGAAAAAAGACCGGG + Intronic
940146880 2:150554700-150554722 TCTAGAAATGAAAACACACAAGG - Intergenic
942342193 2:174960538-174960560 ACTGGAAATTAAAACACAGCTGG + Intronic
944137069 2:196411551-196411573 TCTGTAAAAGGAGACACACCAGG + Intronic
947071735 2:226295319-226295341 GCTGGAAATTGAAAAACACCAGG - Intergenic
947218340 2:227769467-227769489 TCTTTAAATGAAAACACACTGGG + Intergenic
1168924020 20:1565225-1565247 ACTCCAAATCTAAACACACCAGG - Exonic
1169489460 20:6058794-6058816 TATGGCTAAGTAAACACACCTGG + Intergenic
1170054162 20:12180872-12180894 TCTGGAAATGGAAAAACTACAGG - Intergenic
1170391752 20:15882441-15882463 GCTGAGAATGTAACCACACCTGG - Intronic
1174028676 20:47602635-47602657 TCTGGAAATGAAAAGACAGTAGG - Intronic
1175506488 20:59489007-59489029 TGTGGAAAAGTCAACACAGCAGG - Intergenic
1176585043 21:8574967-8574989 TTTAGAAATGTAAACATGCCAGG + Intergenic
1177209970 21:18059047-18059069 TCTGGAAATATAGCCACACTAGG - Intronic
1177930434 21:27275887-27275909 TCTGGGAATATTAACACACTGGG - Intergenic
1179192815 21:39137561-39137583 TCTGGAAATGAGGCCACACCAGG + Intergenic
1180267852 22:10551869-10551891 TTTAGAAATGTAAACATGCCAGG + Intergenic
1180696636 22:17755337-17755359 CCCGGAAATGTGAACACACATGG + Intronic
1181107342 22:20582946-20582968 CCTGGACCTTTAAACACACCTGG + Exonic
1181306968 22:21922607-21922629 TCTGTAAATATGAACCCACCTGG + Exonic
1182061132 22:27398581-27398603 TCTGGAAATGGAAATACTACTGG - Intergenic
1184541939 22:45131892-45131914 TTTGGAAATGCAGACACACCGGG - Intergenic
950621322 3:14207814-14207836 CCTGGAAGTGGTAACACACCTGG + Intergenic
950941235 3:16894398-16894420 TCTGGAAATATACATAAACCAGG - Intronic
952718264 3:36504386-36504408 TCTGGATATGTAAACACTGAAGG - Exonic
955306883 3:57842273-57842295 TCTTGAAAAGTAAACAAACAAGG - Intronic
959478774 3:106845719-106845741 TCTGGTAATGAAAACAGAGCGGG + Intergenic
961476076 3:127147213-127147235 GCTGGAAAGGCAGACACACCTGG - Intergenic
965724801 3:171703919-171703941 AATGGAGATGTAAATACACCTGG + Intronic
966012354 3:175096291-175096313 TCTGGCAATGTAATCATTCCAGG + Intronic
967322983 3:188212534-188212556 TTTGGAAATGTTTACCCACCAGG + Intronic
971191719 4:24434897-24434919 TTCAGAAATGTTAACACACCAGG + Intergenic
971644897 4:29186762-29186784 TCTGGAGATGTGAACAGACATGG + Intergenic
976379261 4:84380516-84380538 TCAGGCAATGAAAACAAACCAGG + Intergenic
978393415 4:108251710-108251732 TCTGGAAATGTAGAGTCACTAGG + Intergenic
978526374 4:109670897-109670919 TCTTGAAATGTAAGCATTCCAGG - Intronic
978562119 4:110044307-110044329 TTTGGGAATGTAACCACTCCTGG - Intergenic
979490051 4:121315731-121315753 TCTGAGAATGTAAACTCACTGGG - Intergenic
979518844 4:121642796-121642818 AATGGAACTGTAAACAGACCAGG - Intergenic
980076639 4:128300869-128300891 TATGGATATGTTAACTCACCTGG - Intergenic
980714934 4:136616124-136616146 TCTGGAAAGGTGAACACAGTGGG - Intergenic
982739634 4:159044212-159044234 TCTGGGAAAGAAAACACAGCTGG + Intergenic
983333747 4:166365768-166365790 TCAGGAAATGGAAACACAATTGG + Intergenic
984237440 4:177177376-177177398 TCTAGGAATGTAAACTCACTAGG - Intergenic
984336883 4:178403703-178403725 GCTGGAAATGTAAAATCACTGGG - Intergenic
984398655 4:179232706-179232728 ACTGGAAAAGTAAACACATTAGG - Intergenic
987136125 5:14901179-14901201 TCTGTAAATGTTAACAGGCCAGG - Intergenic
987552449 5:19401526-19401548 TGTGGAAATGTATACATTCCTGG - Intergenic
987787956 5:22526558-22526580 TCAAGAAATGAAAACACATCTGG + Intronic
989118111 5:37976511-37976533 CCTGCAAATGGAAACACAGCAGG + Intergenic
989601997 5:43208961-43208983 TCTGGAAATGTACACACCCATGG - Intronic
990505643 5:56441570-56441592 TTTGGAAATGAAAACAATCCAGG + Intergenic
993276413 5:85865527-85865549 TCTGGAAATATAAATATACATGG - Intergenic
994239978 5:97407936-97407958 TCAGGGATTGTAAACGCACCAGG + Intergenic
994450005 5:99929697-99929719 TCTGTGAATGTGTACACACCTGG + Intergenic
994533094 5:100991738-100991760 TTTGGAAATGTATACAGAGCTGG - Intergenic
996408757 5:123132553-123132575 TCCTGAAATGTCAACACACTTGG - Intronic
996486992 5:124047709-124047731 TCTTCAAAGGTTAACACACCTGG + Intergenic
997092041 5:130869564-130869586 TCTGGACATTTATACACATCTGG - Intergenic
999992704 5:157063915-157063937 TCTTGCCCTGTAAACACACCAGG - Intergenic
1000363234 5:160467496-160467518 TCTGGAAATGTGAACATTCAAGG - Intergenic
1000481120 5:161775632-161775654 GCTGGTAATGTACAAACACCTGG + Intergenic
1000667981 5:164022644-164022666 TCTGGAAAACTGAAGACACCAGG - Intergenic
1000763804 5:165259405-165259427 GCTGGGAATATAAACAAACCAGG + Intergenic
1003140252 6:3465335-3465357 TATGGAAATGTAAACACAAATGG - Intergenic
1004174503 6:13328297-13328319 TCTAGTAGTGCAAACACACCCGG + Intronic
1005099201 6:22151448-22151470 TGCTGAAATGTAAACACTCCTGG - Intergenic
1007087930 6:39163437-39163459 TCTGTGAATGTTAACACATCTGG + Intergenic
1008914707 6:56774547-56774569 TCTGAAAAGATAAACATACCAGG - Intronic
1009483472 6:64190891-64190913 TCTTGAAACGTCAAGACACCAGG - Intronic
1010650130 6:78444724-78444746 TCTGGAAATATAATCACATTGGG + Intergenic
1011639494 6:89405784-89405806 GCTGCAAATAGAAACACACCAGG - Intronic
1012543110 6:100385456-100385478 TTTTGAAATGTAAACACATCAGG + Exonic
1012548307 6:100446330-100446352 GCTGGAAGTGTTGACACACCAGG - Intronic
1012764433 6:103348175-103348197 TGTGGAAATGTTAACACATTTGG + Intergenic
1014964886 6:127735665-127735687 TCTGAAGTTGTAAACACACATGG - Intronic
1016003957 6:139070290-139070312 CCTTGACATCTAAACACACCAGG + Intergenic
1016811853 6:148269122-148269144 TTTCCAAATGTAAACAAACCTGG - Intergenic
1017066716 6:150535787-150535809 TTTTGAAAGGTAAACACCCCTGG - Intergenic
1018948893 6:168365534-168365556 TGTGGAAATGCACAGACACCTGG + Intergenic
1021019303 7:15576648-15576670 GCTGGAAATTTAAACAAAGCTGG - Intergenic
1022279849 7:28896508-28896530 TCTATAAATGGAACCACACCTGG - Intergenic
1022837764 7:34133359-34133381 TCTGGATAGCTAAACACACAGGG + Intronic
1028808750 7:95060023-95060045 CCTGGAAGTGAAAACACTCCTGG + Intronic
1032994603 7:137431305-137431327 GATGGAAATGTAACCACACAAGG + Intronic
1034642328 7:152614082-152614104 TGTGGAAATGTGAACATGCCTGG + Intergenic
1037296915 8:17411636-17411658 TCTGGAAATGGAAACAAATTGGG - Intronic
1040051792 8:43022268-43022290 TCTGGAAATTTAAAGTCACTAGG + Exonic
1041399284 8:57424828-57424850 TCTGTATTTGTAAACCCACCTGG + Intergenic
1042075062 8:64984684-64984706 TCAGGAAAAATAAACACATCAGG - Intergenic
1042115197 8:65423983-65424005 TCTGGAAATGGTAAAACACTTGG + Intergenic
1044130478 8:88517538-88517560 TCTGGACATGTAGACAGAACAGG - Intergenic
1045662314 8:104450671-104450693 TCTGCTAATGTTACCACACCTGG - Intronic
1046207035 8:111014576-111014598 TTTGCAAATGTAAAGACACCTGG - Intergenic
1046965102 8:120155532-120155554 TTTTGAGATGTCAACACACCTGG + Intronic
1047990906 8:130285607-130285629 TTTGGAAAGTTAAACACAACAGG + Intronic
1048356008 8:133654658-133654680 TCTGGCAATGACATCACACCAGG + Intergenic
1048553035 8:135451480-135451502 ACTGCAAATGTGAACACATCCGG - Intergenic
1050610941 9:7352540-7352562 TCTGAAGATGTGATCACACCAGG - Intergenic
1051821498 9:21174785-21174807 TGTGGAAATGTAAGCACATCTGG + Intergenic
1051844466 9:21435703-21435725 TGTGGAAATGGAAACACTTCTGG - Intronic
1052121293 9:24720345-24720367 TCTGGTACTGAAAACACATCTGG - Intergenic
1054936186 9:70691044-70691066 TTAGGAAATGCAAACACACCTGG + Intronic
1055301667 9:74888983-74889005 TCTGCAAATGTGAATTCACCAGG - Intergenic
1056781247 9:89552935-89552957 TCTGGAAATGTATTCCCCCCGGG + Intergenic
1056969620 9:91191515-91191537 CCTGCAAAATTAAACACACCAGG + Intergenic
1057411657 9:94821560-94821582 CCTGGAAATTCAAACACATCTGG - Intronic
1203582465 Un_KI270746v1:23294-23316 CCAGGAAATGTAAAAACATCAGG + Intergenic
1186659352 X:11653082-11653104 TGTGGAAATAAAAACACACCTGG + Intronic
1187419120 X:19119966-19119988 TCTAGAAAAATACACACACCTGG + Intronic
1188507164 X:30895067-30895089 TCTACAAAAGGAAACACACCTGG + Intronic
1190549507 X:51564135-51564157 TCTGGAAATGAAAACACATAAGG - Intergenic
1192820847 X:74643461-74643483 TCCTTAAATGTAATCACACCTGG + Intergenic
1195141115 X:101961221-101961243 TTTTGAAATGTAAACACCCAGGG - Intergenic
1198231239 X:134691652-134691674 TCTGGAAATGTAAACACACCTGG + Intronic
1198606031 X:138338714-138338736 TCTGTCAATGTAAAAACAACTGG + Intergenic
1199404810 X:147444430-147444452 TTTGGAAGTTAAAACACACCAGG - Intergenic