ID: 1198231424

View in Genome Browser
Species Human (GRCh38)
Location X:134693150-134693172
Sequence TGCCCACCCCCATGTATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198231421_1198231424 -5 Left 1198231421 X:134693132-134693154 CCCTTCCACAGGCTTTACTGCCC 0: 1
1: 0
2: 0
3: 17
4: 170
Right 1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
1198231422_1198231424 -6 Left 1198231422 X:134693133-134693155 CCTTCCACAGGCTTTACTGCCCA 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
1198231418_1198231424 19 Left 1198231418 X:134693108-134693130 CCTCCAACAGCATATTTTATTAT 0: 1
1: 0
2: 3
3: 36
4: 372
Right 1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
1198231417_1198231424 22 Left 1198231417 X:134693105-134693127 CCTCCTCCAACAGCATATTTTAT 0: 1
1: 0
2: 0
3: 23
4: 257
Right 1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
1198231419_1198231424 16 Left 1198231419 X:134693111-134693133 CCAACAGCATATTTTATTATTCC 0: 1
1: 0
2: 3
3: 32
4: 333
Right 1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
1198231423_1198231424 -10 Left 1198231423 X:134693137-134693159 CCACAGGCTTTACTGCCCACCCC 0: 1
1: 0
2: 0
3: 42
4: 268
Right 1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
1198231416_1198231424 30 Left 1198231416 X:134693097-134693119 CCTGGCTTCCTCCTCCAACAGCA 0: 1
1: 0
2: 1
3: 41
4: 436
Right 1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198231424 Original CRISPR TGCCCACCCCCATGTATTTC AGG Intronic
900073974 1:797176-797198 TGCCCTTCCCCATGTATGTGAGG - Intergenic
902119425 1:14149470-14149492 TGCCCAGTCCCAAGTCTTTCCGG + Intergenic
902933168 1:19745493-19745515 TGCCCACCCCCCTCCACTTCTGG + Intronic
903054726 1:20627777-20627799 TCCCCACCCCCATGTCCTTTGGG + Intergenic
903983017 1:27203581-27203603 GCCCCTCCTCCATGTATTTCTGG + Intergenic
906037967 1:42764627-42764649 TGCCCAGCACCATGTATTACAGG - Intronic
906076724 1:43057337-43057359 TGACCACTCCCGTGTTTTTCAGG + Intergenic
906346137 1:45015757-45015779 TACCCTACCCCATGTAGTTCTGG - Intergenic
908609786 1:65845031-65845053 TGCCCACCCCCATCTGTCTAAGG + Intronic
915926608 1:160026084-160026106 TTACCACCCCCATGTTTTTAGGG + Intergenic
919981010 1:202643045-202643067 TTCCGACGCCCATGGATTTCCGG + Intronic
921584375 1:216930324-216930346 TGCCCTCCCCCATGAATACCAGG + Intronic
922269829 1:224022084-224022106 TGCCCTTCCCCATGTATGTGAGG - Intergenic
1064635395 10:17360579-17360601 TTCCCACCCCCACCTCTTTCTGG - Intronic
1065428212 10:25627698-25627720 TTCCCATCCCCATGGGTTTCAGG + Intergenic
1067663680 10:48255574-48255596 TGCCCATCCCCATGACTCTCAGG - Intronic
1068137951 10:52969546-52969568 GTCCCACTCTCATGTATTTCTGG - Intergenic
1069862192 10:71478678-71478700 TGCCCCCTCCCATCTATCTCTGG + Intronic
1072434710 10:95404438-95404460 TGCACACACTCATGAATTTCAGG - Intronic
1075724406 10:124604140-124604162 TGCCCAGACCCATGTACCTCTGG - Intronic
1076003717 10:126931651-126931673 TCCACATTCCCATGTATTTCAGG + Intronic
1077050899 11:566346-566368 AGCCCACCCCCATGTCCTCCCGG + Intergenic
1077887264 11:6395279-6395301 TCTCCATCCCCATGTGTTTCAGG - Exonic
1078182701 11:9026058-9026080 TGCCAAGCCCCAGGTCTTTCAGG - Intronic
1082644326 11:55702435-55702457 AGCCCATTCCCATGGATTTCAGG + Intergenic
1083590695 11:63892242-63892264 GGTCCAACCCCATGTGTTTCTGG + Intronic
1089176943 11:116555629-116555651 TCCCCACCCCCATCTTTTTGTGG + Intergenic
1090639758 11:128720487-128720509 TCCCCACCCCCCAGTGTTTCTGG - Intronic
1096499455 12:52056125-52056147 TGCCCACCGCCAGGCACTTCTGG - Exonic
1096745748 12:53725869-53725891 TGCCTACCCCCATGAATTCTAGG + Intronic
1096879966 12:54659449-54659471 TGCCCACGTCCATGTCTTTCAGG - Intergenic
1098742545 12:74192657-74192679 TCCCCACCCACTTGCATTTCGGG - Intergenic
1100316264 12:93447518-93447540 TACCCACCCCCAAATATTCCAGG + Intergenic
1101859550 12:108471925-108471947 TCCCCACCCCCAGGTCTCTCTGG + Intergenic
1101907976 12:108841980-108842002 TGCACACCACCTTGTATTTTTGG - Intronic
1102626989 12:114243078-114243100 TGCCCACCCCAAAGTATGTTGGG - Intergenic
1103302541 12:119939047-119939069 TGCCCACCACCATCTGTTTGTGG + Intergenic
1104178496 12:126355632-126355654 TGCCCATCCCCATGTGCATCTGG - Intergenic
1107426069 13:40294060-40294082 TGCCCACGCACAGATATTTCTGG + Intergenic
1109580459 13:64325193-64325215 TGCCTTCCCTCTTGTATTTCTGG - Intergenic
1110694968 13:78477429-78477451 CCCTCACCTCCATGTATTTCAGG + Intergenic
1111463779 13:88580716-88580738 TGGTCACCCTCATGAATTTCTGG + Intergenic
1116733472 14:48657001-48657023 TGCCCACACCCATCTATACCTGG + Intergenic
1120062587 14:80001609-80001631 TGCCCCCCGCCATGTATCACAGG - Intergenic
1121553286 14:94818615-94818637 TTCCCACCTCCAGGTATTACAGG + Intergenic
1122533279 14:102444095-102444117 TGCCCACCGTCAGGTAGTTCTGG + Intronic
1124496708 15:30191791-30191813 TTCCGACGCCCATGGATTTCCGG + Intergenic
1124657135 15:31517720-31517742 TGCCCACCCCCATCTTTCTCAGG - Intronic
1124746868 15:32346857-32346879 TTCCGACGCCCATGGATTTCCGG - Intergenic
1128156349 15:65394255-65394277 TGCCCAGACCCCTGTTTTTCAGG + Intronic
1132866580 16:2095855-2095877 TGACCAGCCCCAGGTATCTCCGG - Intronic
1137436941 16:48462829-48462851 TTCAAACCCTCATGTATTTCTGG - Intergenic
1137686244 16:50388888-50388910 TGCCCAACCCCATCTTTCTCTGG - Intergenic
1141127962 16:81414573-81414595 TCCCCACCCCCACGTATACCAGG - Intergenic
1141950837 16:87338479-87338501 TTCCCACCCCTGTGTGTTTCAGG - Intronic
1143314008 17:6017627-6017649 TGCACACACTCATGTATTTTTGG + Intronic
1145144324 17:20467850-20467872 TGCCCAGCCCCATTATTTTCTGG - Intergenic
1145175775 17:20699253-20699275 TGCCCAGCCCCATTATTTTCTGG - Intergenic
1145791542 17:27630862-27630884 TGCCCAGCCCCATTATTTTCTGG + Exonic
1146595530 17:34165180-34165202 TGCCCACCCCCAGGAGTCTCTGG - Intronic
1146693488 17:34892543-34892565 TCACCACCCTCATGCATTTCTGG + Intergenic
1147589821 17:41675170-41675192 TGCCCTCCCCCACCTCTTTCAGG + Intergenic
1152664375 17:81558847-81558869 TCCCTGCCCCCATGTTTTTCTGG - Exonic
1152919912 17:83061166-83061188 TGCCCAGACTCAGGTATTTCTGG + Intergenic
1155314980 18:24562600-24562622 ATCCCACTCCCATGTTTTTCCGG - Intergenic
1159912244 18:74156614-74156636 TTACCACCCACAGGTATTTCCGG - Intronic
926977626 2:18531080-18531102 TACCCACTGCCATGTAGTTCAGG - Intergenic
929385108 2:41397156-41397178 TTCCCAGCACCATGTATTTAAGG + Intergenic
929710707 2:44263663-44263685 TGCCCTCCCCCAGGAATATCAGG - Intergenic
931753520 2:65351328-65351350 TGCCCCTCCCCATTTCTTTCAGG + Intronic
932217343 2:69975436-69975458 TGCCTCCTCCCATGTACTTCAGG + Intergenic
932399434 2:71469553-71469575 AGCCCAGCCCCATACATTTCAGG - Intronic
939170706 2:138691704-138691726 TTTCCATCTCCATGTATTTCAGG - Intronic
940027173 2:149220374-149220396 TACCCACCCCCATGTTTTGCAGG - Intergenic
944649390 2:201814120-201814142 TGCCCACAGCCAAGTTTTTCAGG + Intronic
1170211091 20:13846921-13846943 TGCCCTCCCTCTTATATTTCAGG + Intergenic
1171401384 20:24874900-24874922 TGCCCACCTGCCTGTATTTTGGG - Intergenic
1172054811 20:32146763-32146785 TCCTCACCGCCATCTATTTCAGG + Exonic
1173783004 20:45771989-45772011 TTCCCACCCCCAGGTCTTTCTGG - Intronic
1174994535 20:55551080-55551102 TTCACATCCCCACGTATTTCCGG - Intergenic
1181828986 22:25544033-25544055 TGCCTAACCCCTGGTATTTCAGG + Intergenic
949998656 3:9639638-9639660 TGCCCACCACCATGTCTAGCAGG + Intergenic
950359057 3:12437551-12437573 TGCCCATCCCCATTGCTTTCTGG + Intergenic
954290306 3:49646453-49646475 AGCCCAGCCCCATGTATCACAGG - Intronic
954608151 3:51929548-51929570 TGCTCACCCCCACCTCTTTCTGG - Intergenic
959930029 3:111970368-111970390 TCCCCACCCCCTTTTTTTTCTGG - Intronic
961241591 3:125416368-125416390 TTCCCACCCCCAAGGATTTCTGG - Intergenic
966465294 3:180225103-180225125 TGCCTGCCCCCTTGTATTTCAGG + Intergenic
969072334 4:4549451-4549473 TGCCCACCTCCAAGTAGCTCTGG - Intergenic
969091236 4:4695502-4695524 TGGCCACCTCCTTGTAGTTCTGG + Intergenic
969533690 4:7742861-7742883 TGTGCACCCACATGCATTTCAGG - Intergenic
971716042 4:30178693-30178715 TACCCAATCTCATGTATTTCTGG - Intergenic
980019919 4:127696523-127696545 TGCCCCCCCCCTTTCATTTCTGG + Intronic
981651318 4:147062260-147062282 TCCCCACCCCCATGTAGCTATGG + Intergenic
983934644 4:173492887-173492909 TCCCCACCGCCCTGTATTGCAGG - Intergenic
984961642 4:185103119-185103141 TGCCCACCCCTACATATTGCTGG - Intergenic
986314543 5:6577784-6577806 TGTCCAACCCCATGTATGGCTGG + Intergenic
987170590 5:15253292-15253314 TGCCCACTCCCAGGTATTCATGG - Intergenic
991202426 5:64009646-64009668 TGTCCACCCACATGCATTTGAGG + Intergenic
996868704 5:128160437-128160459 TTCCAACCCCCATTTTTTTCTGG - Intronic
1002302175 5:178263324-178263346 TGCCAAGCCCCATCTCTTTCAGG - Exonic
1004420895 6:15468985-15469007 TGACCATCCCCATGTAGATCTGG - Intronic
1004609779 6:17229205-17229227 TTCCACCACCCATGTATTTCTGG + Intergenic
1006611521 6:35297081-35297103 GGCTCACCCCCATGTGTTTCAGG + Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1013376580 6:109521859-109521881 TCCCCACCCCCATGTTTCTAGGG + Intronic
1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG + Intergenic
1015143844 6:129964049-129964071 TCCCCACCCCCACTTCTTTCAGG - Intergenic
1017058229 6:150456700-150456722 TACACACCCCCAGGTATTTATGG + Intergenic
1019425675 7:975486-975508 TGTCGACCGCCATGAATTTCGGG - Exonic
1020462251 7:8438982-8439004 TTCCCACCCCCATGCATTTATGG - Intronic
1021333699 7:19371611-19371633 TCCCCACCCCCATCCATCTCTGG + Intergenic
1022443583 7:30452474-30452496 TGCCCACCCCCTGGTCTTGCTGG - Exonic
1027160418 7:75798369-75798391 TTCCCATCCCCATGTCCTTCTGG - Intergenic
1028832369 7:95341941-95341963 TGCCCACCACCAGGAATGTCAGG + Intergenic
1029538753 7:101171044-101171066 TTCCCACCTCCTGGTATTTCTGG - Exonic
1029805101 7:102987799-102987821 TCCCCACCCCTCTGTATTCCTGG - Intronic
1033141208 7:138828487-138828509 CACCCACCCCCATTTATTCCAGG + Intronic
1033849760 7:145481310-145481332 GGCCCACCCTCATGGAATTCTGG + Intergenic
1035541659 8:444301-444323 TGCCCTTCCCCATGTATGTGAGG + Intronic
1039026718 8:33266847-33266869 TCCTCTCCCCCATATATTTCAGG + Intergenic
1040964352 8:53069536-53069558 TTCACAGCCTCATGTATTTCAGG - Intergenic
1041834780 8:62199134-62199156 TACCCAACTCCAGGTATTTCAGG + Intergenic
1046773251 8:118137375-118137397 CCCCCACCCCCAAGTTTTTCTGG - Intergenic
1050749880 9:8924726-8924748 TCCCTACCCCCATCAATTTCTGG + Intronic
1051131181 9:13862706-13862728 TGTCCAGCCCCATTTATTTCAGG - Intergenic
1057707241 9:97404673-97404695 CTCCCACCCCCATGTCTTTTGGG - Intergenic
1060281041 9:122215866-122215888 TGCCCAACCCCCAGTTTTTCTGG - Intronic
1061410748 9:130420028-130420050 AGCAGACCCCCATGTATTTCAGG + Intronic
1189960393 X:46318862-46318884 TGCCCTCAACTATGTATTTCAGG - Intergenic
1190588735 X:51975343-51975365 TAACAACCCCCATGGATTTCTGG + Intergenic
1191607355 X:63077424-63077446 TCCCCACCCCCAGGAATGTCAGG + Intergenic
1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG + Intronic
1198257258 X:134934528-134934550 TGTCCACCTTCATGTAGTTCTGG + Intergenic