ID: 1198235992

View in Genome Browser
Species Human (GRCh38)
Location X:134736432-134736454
Sequence CTAAGCAGCTGCCTCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198235992_1198236002 26 Left 1198235992 X:134736432-134736454 CCAGGAAAGAGGCAGCTGCTTAG No data
Right 1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198235992 Original CRISPR CTAAGCAGCTGCCTCTTTCC TGG (reversed) Intronic