ID: 1198235995

View in Genome Browser
Species Human (GRCh38)
Location X:134736465-134736487
Sequence TCGGGGCGGTGGGGGCGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198235995_1198236002 -7 Left 1198235995 X:134736465-134736487 CCAAACCGCCCCCACCGCCCCGA No data
Right 1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG No data
1198235995_1198236007 9 Left 1198235995 X:134736465-134736487 CCAAACCGCCCCCACCGCCCCGA No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198235995_1198236011 27 Left 1198235995 X:134736465-134736487 CCAAACCGCCCCCACCGCCCCGA No data
Right 1198236011 X:134736515-134736537 AGAGGTATAGAATAAAAGAAAGG No data
1198235995_1198236012 28 Left 1198235995 X:134736465-134736487 CCAAACCGCCCCCACCGCCCCGA No data
Right 1198236012 X:134736516-134736538 GAGGTATAGAATAAAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198235995 Original CRISPR TCGGGGCGGTGGGGGCGGTT TGG (reversed) Intronic