ID: 1198236002

View in Genome Browser
Species Human (GRCh38)
Location X:134736481-134736503
Sequence GCCCCGACTCCTGCTTCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198235993_1198236002 -5 Left 1198235993 X:134736463-134736485 CCCCAAACCGCCCCCACCGCCCC No data
Right 1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG No data
1198235994_1198236002 -6 Left 1198235994 X:134736464-134736486 CCCAAACCGCCCCCACCGCCCCG No data
Right 1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG No data
1198235992_1198236002 26 Left 1198235992 X:134736432-134736454 CCAGGAAAGAGGCAGCTGCTTAG No data
Right 1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG No data
1198235995_1198236002 -7 Left 1198235995 X:134736465-134736487 CCAAACCGCCCCCACCGCCCCGA No data
Right 1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198236002 Original CRISPR GCCCCGACTCCTGCTTCTTA AGG Intronic