ID: 1198236007

View in Genome Browser
Species Human (GRCh38)
Location X:134736497-134736519
Sequence CTTAAGGCCCAAGTGACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198235994_1198236007 10 Left 1198235994 X:134736464-134736486 CCCAAACCGCCCCCACCGCCCCG No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198235998_1198236007 0 Left 1198235998 X:134736474-134736496 CCCCACCGCCCCGACTCCTGCTT No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198236004_1198236007 -9 Left 1198236004 X:134736483-134736505 CCCGACTCCTGCTTCTTAAGGCC No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198236003_1198236007 -8 Left 1198236003 X:134736482-134736504 CCCCGACTCCTGCTTCTTAAGGC No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198235997_1198236007 1 Left 1198235997 X:134736473-134736495 CCCCCACCGCCCCGACTCCTGCT No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198235999_1198236007 -1 Left 1198235999 X:134736475-134736497 CCCACCGCCCCGACTCCTGCTTC No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198236005_1198236007 -10 Left 1198236005 X:134736484-134736506 CCGACTCCTGCTTCTTAAGGCCC No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198236001_1198236007 -5 Left 1198236001 X:134736479-134736501 CCGCCCCGACTCCTGCTTCTTAA No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198236000_1198236007 -2 Left 1198236000 X:134736476-134736498 CCACCGCCCCGACTCCTGCTTCT No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198235996_1198236007 4 Left 1198235996 X:134736470-134736492 CCGCCCCCACCGCCCCGACTCCT No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198235993_1198236007 11 Left 1198235993 X:134736463-134736485 CCCCAAACCGCCCCCACCGCCCC No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data
1198235995_1198236007 9 Left 1198235995 X:134736465-134736487 CCAAACCGCCCCCACCGCCCCGA No data
Right 1198236007 X:134736497-134736519 CTTAAGGCCCAAGTGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198236007 Original CRISPR CTTAAGGCCCAAGTGACCAG AGG Intronic