ID: 1198238037

View in Genome Browser
Species Human (GRCh38)
Location X:134755277-134755299
Sequence AAGAGCTACCACTTAATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198238037 Original CRISPR AAGAGCTACCACTTAATAGT TGG (reversed) Intronic
902324130 1:15687501-15687523 AAAAGCTACCAGTTAAGACTGGG - Intronic
906422522 1:45682544-45682566 AACAGATAATACTTAATAGTTGG - Intronic
908831910 1:68187350-68187372 GAGAACTAGCACTTAATAGGGGG - Intronic
910131099 1:83907447-83907469 ATGACCTACCACTTGAGAGTTGG + Exonic
910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG + Intergenic
912401878 1:109400190-109400212 AAGAGCTACTCCTTAGTATTTGG + Exonic
915660029 1:157396920-157396942 AAGAGCTACCTCTTCAAGGTAGG - Intergenic
916338753 1:163704176-163704198 AAGAGCTACAGCTGAATACTTGG + Intergenic
924121500 1:240804107-240804129 AAGAACTACCACTTACAAATGGG + Intronic
924677265 1:246192043-246192065 AAGAACTTTCACTTAAAAGTTGG + Intronic
1067340515 10:45398760-45398782 ATGAGATACCACTTGATACTAGG + Intronic
1067433163 10:46257366-46257388 AAGAGCTTCCACCCAAAAGTAGG - Intergenic
1070397701 10:76025872-76025894 TATACCTACTACTTAATAGTAGG + Intronic
1071341442 10:84652343-84652365 ATGAGATATTACTTAATAGTTGG - Intergenic
1076434108 10:130427722-130427744 AGGAGCACCCACTTAGTAGTCGG - Intergenic
1081268061 11:41051209-41051231 AAAAGCTAACACTTAAATGTTGG + Intronic
1085905218 11:80751982-80752004 AAGAGCTACCATTAGATTGTTGG + Intergenic
1087851028 11:103029375-103029397 AAGAGTGACCACTTATTAGCTGG - Intergenic
1089225854 11:116920969-116920991 AACAGCTACCAAATTATAGTTGG - Intronic
1089598133 11:119595222-119595244 AAGAGCTTCCAATTAACAGTCGG + Intergenic
1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG + Intergenic
1092137327 12:6159107-6159129 AAGAGCTTACACTTAATGGAGGG + Intergenic
1093515606 12:19983025-19983047 AAAACCTTCTACTTAATAGTTGG - Intergenic
1098329384 12:69336766-69336788 AAGAGCAACAATTTAATTGTAGG + Intergenic
1104183626 12:126406669-126406691 CAGAGCGGTCACTTAATAGTAGG + Intergenic
1105646132 13:22319570-22319592 AAGAGATACCACTTGACACTAGG - Intergenic
1106482729 13:30148951-30148973 AAGATCCACCACTTAACAGAGGG - Intergenic
1107250866 13:38361050-38361072 AAAAGCTTCCAGTTAACAGTTGG - Exonic
1110372988 13:74760084-74760106 AGGAGCTACCACTGCATAGCAGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113515625 13:110895167-110895189 AGAAGCTACCACTTAGTATTAGG + Intronic
1115813924 14:37142296-37142318 AAGAGCTACCACTCTGGAGTTGG - Intronic
1117802664 14:59461338-59461360 TAGTTCTACCACTAAATAGTTGG + Exonic
1124962000 15:34405641-34405663 AAGAGCTCCCACCTAACTGTGGG - Intronic
1124978623 15:34551862-34551884 AAGAGCTCCCACCTAACTGTGGG - Intronic
1128413756 15:67424473-67424495 AAGAGCTTACAATTAATAGGAGG - Intronic
1133915904 16:10109661-10109683 AAGACCTACCATTTAATAAATGG + Intronic
1137003834 16:35254358-35254380 TTGAGCTACCACTTATAAGTGGG - Intergenic
1144487995 17:15683660-15683682 CACAACCACCACTTAATAGTAGG + Intronic
1147849939 17:43434369-43434391 AATAGCTTCTACTTAATACTAGG - Intergenic
1155868653 18:30997934-30997956 AACAGCTACCACATAAGATTAGG + Intronic
1155905214 18:31442591-31442613 ATTAGCTACCACTTAATGGTGGG + Intergenic
1158684784 18:59603653-59603675 AAGAGCAACAACTTTGTAGTAGG - Intronic
1159391848 18:67803594-67803616 AATAGCTACTACCTAATAATTGG - Intergenic
1163058729 19:14742599-14742621 ACCAACTACCACTTAGTAGTGGG - Intronic
925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG + Intronic
926293704 2:11551879-11551901 AAGTGCTACAACTTAAAAGAGGG - Intronic
934520480 2:95017200-95017222 AAGAACTACCACTTGCTAGGAGG + Intergenic
935618276 2:105107792-105107814 AAGAGATTCAACTTAATAGAGGG - Intergenic
939516996 2:143181686-143181708 AAGAGCTAACACCTAATTGAGGG - Intronic
939752794 2:146068280-146068302 AAAAGCTACAGCTTAGTAGTAGG + Intergenic
941719666 2:168799924-168799946 GAGAGCTTCCACTTCATAATAGG - Intronic
942783539 2:179673739-179673761 AACAGATTCCACTTAATTGTTGG - Intronic
943776957 2:191775954-191775976 CAGAGCTACCACTAACCAGTTGG + Intergenic
1172063695 20:32204994-32205016 AAGAGCTGCCACTTACTGGCTGG + Intronic
949792877 3:7812334-7812356 AAGAGCTACTCTTTAAAAGTTGG + Intergenic
954065176 3:48100151-48100173 CAGATCTACCACTTACTGGTTGG - Intergenic
956546115 3:70405166-70405188 AAGGGTCACCACATAATAGTAGG + Intergenic
958441232 3:94158548-94158570 AAGAGCTACCATTTCATAGGAGG + Intergenic
959137608 3:102443876-102443898 AAGCACTACCACTAAAAAGTAGG - Intronic
959530196 3:107427611-107427633 TAGTTCTGCCACTTAATAGTAGG - Intergenic
960703858 3:120463031-120463053 GAGACCTGCCACTTACTAGTTGG + Intergenic
960745030 3:120878138-120878160 AATAGCTACCATATATTAGTAGG + Intergenic
966435511 3:179879477-179879499 AACAGCTACCATTTGATGGTGGG - Intronic
966689599 3:182729233-182729255 AAGAGCTACCACATTGTAGGAGG + Intergenic
969593635 4:8135838-8135860 AAGAGCTCCCACTTCACAGGTGG + Intronic
970105700 4:12580742-12580764 AAGAGCTCCCAATTGCTAGTTGG + Intergenic
970716923 4:18937170-18937192 TAGAGCTAGGACTTAAAAGTTGG - Intergenic
972405234 4:38739724-38739746 AGGAGCTACCACTTATTGGGTGG + Intergenic
972923265 4:43969976-43969998 AAGAACTACCACTGAAAAGATGG + Intergenic
975251749 4:72187868-72187890 AAAAGCTACCAGTAAATATTTGG - Intergenic
978631841 4:110756612-110756634 AAGAGGTACCAATTCATAATGGG - Intergenic
989296506 5:39833484-39833506 AACATCTACTACTTCATAGTTGG - Intergenic
990902870 5:60772182-60772204 AATAGCTCACAGTTAATAGTAGG - Intronic
992476789 5:77110518-77110540 AAGGGCTGCCAGTGAATAGTGGG + Intergenic
993504876 5:88696156-88696178 AAGAGCTTCCACTTAGCGGTTGG - Intergenic
994148270 5:96419558-96419580 TAGATCTGCCACTTAGTAGTTGG - Intronic
999944849 5:156583824-156583846 AAGTGATACCACATAATAGTGGG + Intronic
1000585045 5:163086974-163086996 AAGAGCTATAACTTACTATTTGG - Intergenic
1002778272 6:347244-347266 AAGAGCCACTACTTGAGAGTGGG + Intronic
1003671375 6:8163496-8163518 AAGAGCTTGTACTTAAGAGTCGG - Intergenic
1003914145 6:10769896-10769918 AAGAGCTACCACTAATTAAGTGG - Intronic
1005451999 6:25982572-25982594 AACAACTACCACTTATTAGGTGG + Intronic
1008492770 6:52103313-52103335 AAGAGTTTCCACTTCATAGATGG - Intergenic
1009358122 6:62777605-62777627 AAGAACTCCCACTGAAAAGTAGG - Intergenic
1016672860 6:146729072-146729094 GAGAGCAACCACCTAACAGTGGG - Intronic
1016727042 6:147383751-147383773 AAGAGCTACCACTACAGATTGGG - Intronic
1017418573 6:154248166-154248188 AAGAGCTAGTACAGAATAGTAGG - Intronic
1020886420 7:13823789-13823811 AAGATCTACCTGTTAACAGTGGG - Intergenic
1023104643 7:36751557-36751579 TAGAGCAACCACTTAACACTTGG + Intergenic
1024480776 7:49860230-49860252 AGGAGATACCACTTAACAGGCGG - Intronic
1027683910 7:81257022-81257044 AGGAGCTACCAATGTATAGTGGG + Intergenic
1029106036 7:98176897-98176919 CAGCACTACCACTTAAGAGTTGG - Intronic
1031800612 7:126239731-126239753 AAGATATTCTACTTAATAGTAGG - Intergenic
1031895517 7:127344000-127344022 AAGAGCTAACATTTAAAAGCTGG + Intergenic
1038864186 8:31421469-31421491 AAGAGTTACCACTGAACATTTGG - Intergenic
1044967399 8:97586518-97586540 ATGAGCTCCAACTTACTAGTGGG + Intergenic
1045880125 8:107028892-107028914 AAGAGTGACCACTTAATAGGTGG - Intergenic
1046537367 8:115532558-115532580 CAGAGCTACTCCCTAATAGTAGG + Intronic
1046740274 8:117820279-117820301 CAGATCTACCACTTACTGGTCGG + Intronic
1052407944 9:28086097-28086119 AGGAGCTAGCAGTTAACAGTGGG + Intronic
1056882033 9:90404148-90404170 AATAGCTACCATTTATTAATTGG + Intergenic
1060575478 9:124688472-124688494 CAGAGTTACCAATTAATGGTTGG + Intronic
1188698870 X:33234326-33234348 AACCTCTACCACTTAATAGATGG + Intronic
1190404714 X:50075254-50075276 AAGGGCTAAGCCTTAATAGTAGG - Intronic
1193797416 X:85892783-85892805 TAGAGCTACTACTTAAAAATGGG - Intronic
1196436716 X:115681271-115681293 AACAGCTTTTACTTAATAGTTGG - Intergenic
1198238037 X:134755277-134755299 AAGAGCTACCACTTAATAGTTGG - Intronic
1199710654 X:150466875-150466897 CAGAGCTTTCACTTAATTGTTGG - Intronic