ID: 1198245271

View in Genome Browser
Species Human (GRCh38)
Location X:134824989-134825011
Sequence ATGTGCCAATGCAGGTTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198245266_1198245271 11 Left 1198245266 X:134824955-134824977 CCTAAATGTAAACTATGAACTTT 0: 2
1: 57
2: 316
3: 749
4: 1338
Right 1198245271 X:134824989-134825011 ATGTGCCAATGCAGGTTCATTGG 0: 1
1: 0
2: 5
3: 36
4: 126
1198245265_1198245271 22 Left 1198245265 X:134824944-134824966 CCAGGAGTGAACCTAAATGTAAA 0: 1
1: 0
2: 52
3: 323
4: 848
Right 1198245271 X:134824989-134825011 ATGTGCCAATGCAGGTTCATTGG 0: 1
1: 0
2: 5
3: 36
4: 126
1198245264_1198245271 28 Left 1198245264 X:134824938-134824960 CCAACACCAGGAGTGAACCTAAA 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1198245271 X:134824989-134825011 ATGTGCCAATGCAGGTTCATTGG 0: 1
1: 0
2: 5
3: 36
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198245271 Original CRISPR ATGTGCCAATGCAGGTTCAT TGG Intronic
902070864 1:13735698-13735720 ATATGTCAGTGCAGGTTCATGGG - Intronic
902080613 1:13818138-13818160 ATCTGCTAATGCAGGTTCCCTGG - Intronic
903643729 1:24877866-24877888 ATGTGTCAATGTCAGTTCATCGG - Intergenic
904964295 1:34359709-34359731 ATGTGGGATTGCAGGTTCATAGG - Intergenic
907095086 1:51770975-51770997 ATGTGTCAATGTAGGCTCATTGG + Intronic
908579983 1:65504766-65504788 ATGTACCAATATTGGTTCATTGG + Intronic
909816666 1:80002978-80003000 ATGTGTCAATATAGATTCATGGG + Intergenic
914169821 1:145213615-145213637 ATGTGCCAATTCTGGGTCTTAGG + Intergenic
914524939 1:148457580-148457602 ATGTGCCAATTCTGGGTCTTAGG + Intergenic
914598736 1:149178253-149178275 ATGTGCCAATTCTGGGTCTTAGG - Intergenic
914641462 1:149609556-149609578 ATGTGCCAATTCTGGGTCTTAGG - Intergenic
916835935 1:168544758-168544780 GTATGCCAATGCAGATTCACTGG - Intergenic
916838533 1:168575816-168575838 GTATGCCAATGCAGATTCACTGG + Intergenic
918273865 1:182931744-182931766 ATGTGTCAATATAGGTTCATCGG - Intronic
918960988 1:191277544-191277566 ATGTGCATATGGAGGTGCATAGG - Intergenic
920084883 1:203408065-203408087 ATGTTAAAATGTAGGTTCATCGG - Intergenic
920757319 1:208745644-208745666 GTGTGTCAATGAAGGTTCATCGG + Intergenic
922615447 1:226958543-226958565 CTGGGCCAGGGCAGGTTCATCGG + Intronic
923085498 1:230700486-230700508 ATGTGTCAATGTAGGTTCGTGGG + Intergenic
923456009 1:234166293-234166315 ATGTGTCAGTGCAGGGTCATTGG - Intronic
923940752 1:238823085-238823107 GTGTGTCAATGTAGGTTTATGGG + Intergenic
924224791 1:241912601-241912623 ATGTGTCAATGTTGGTTCACAGG + Intergenic
924240857 1:242038920-242038942 ATGTGTCCACGTAGGTTCATGGG - Intergenic
924866970 1:247993864-247993886 AGGTACCAATGCATGTCCATTGG - Intronic
1063808225 10:9672474-9672496 ATGTGCCAGTGGAAGTCCATGGG + Intergenic
1063896684 10:10689688-10689710 ATTTGCTAATCCAGGTTCTTCGG - Intergenic
1064721270 10:18231590-18231612 ATGTGCCAGTGAAGGTTCAATGG - Intronic
1067676999 10:48389937-48389959 ATGTGGGTATGGAGGTTCATAGG + Intronic
1070495000 10:77013494-77013516 CTGTGCCAAGGCAGATTGATTGG - Intronic
1070791983 10:79195088-79195110 CTGTCCCAAGGCAGGTCCATGGG - Intronic
1072341185 10:94452269-94452291 GTGTGTCAATGTAAGTTCATTGG - Intronic
1073608878 10:104923533-104923555 ATGAGCCAATGCAACTTCATAGG + Intronic
1074188576 10:111116796-111116818 CTGTAACAATGCAGATTCATAGG - Intergenic
1077456326 11:2683362-2683384 GTCTGCAAATGCAGGTTCCTGGG + Intronic
1081565198 11:44256433-44256455 ATCTGCAAATGCAGTTACATTGG - Intergenic
1081596428 11:44462606-44462628 ATGTGGCTATGCATGTTCATGGG + Intergenic
1083191549 11:61055958-61055980 TTGTGAAAATGCAGGTTCCTGGG + Intergenic
1089932344 11:122326145-122326167 ATGTGTCAATGTAGATTTATTGG + Intergenic
1090745688 11:129703122-129703144 ATGTGCCAGTGCAGGTGGAGGGG - Intergenic
1092966695 12:13650585-13650607 ATTTGCCAATTGATGTTCATGGG - Intronic
1093175810 12:15911895-15911917 ATGTAACACTGCAGATTCATGGG + Intronic
1093588844 12:20874738-20874760 AGTTGCAAATGCAGGTTCCTGGG + Intronic
1095254902 12:40023218-40023240 TTGTGCTAAGGCAGGATCATTGG - Intronic
1096524863 12:52204456-52204478 AGGAGGCAATGCAGGTTCAGAGG - Intergenic
1099821672 12:87719259-87719281 AAGTGCCAATGCTGGATTATCGG - Intergenic
1100100487 12:91097900-91097922 AAGTGCCATTGCTGGATCATAGG - Intergenic
1101043931 12:100785222-100785244 ATGTGTCCATGTAAGTTCATTGG - Intronic
1101715073 12:107303740-107303762 ATGTGACAATGAAGGTACATGGG - Intergenic
1101896088 12:108758014-108758036 ACGTGCCCATGCAGGTTCCCTGG + Intergenic
1102971005 12:117166354-117166376 ATGCGTCAGTGCAGGTTCACTGG + Intronic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110966427 13:81704017-81704039 ATGTGTCAGTGTAGATTCATAGG + Intergenic
1112882780 13:104129685-104129707 ATGTACCAGTGTGGGTTCATTGG + Intergenic
1112939547 13:104844869-104844891 ATGTGCCAATGTAGATTCATTGG + Intergenic
1113225275 13:108152791-108152813 TTTTGCAAAGGCAGGTTCATTGG - Intergenic
1113391550 13:109902442-109902464 CTGTGGCAATTCAGGTTCAGAGG - Intergenic
1114364503 14:22012434-22012456 ATGTGCCCATGCAGGCTCTCTGG + Intergenic
1114782541 14:25554448-25554470 ATGTGTCAATATAGGGTCATAGG - Intergenic
1116089026 14:40280296-40280318 ACGTGTCAATGTAGGTTCATCGG - Intergenic
1118743793 14:68759753-68759775 ATGAGGAAATGCAGGTTCAAAGG - Intergenic
1119084999 14:71731406-71731428 ATGTGCCAACCTTGGTTCATCGG - Intronic
1125328296 15:38559294-38559316 ATGTTGCAATGCAGGGTCAAGGG - Intronic
1127240423 15:57107583-57107605 ATGTGTCAATATAGGTTCATTGG + Intronic
1136244648 16:28967474-28967496 AAGTGCCAATACAGGCTCCTGGG + Intergenic
1138962261 16:62041230-62041252 ATGTGCCATTGCAGATATATAGG + Intergenic
1140855757 16:78976324-78976346 ATGAGCAAAAGCAGCTTCATCGG - Intronic
1142363875 16:89639655-89639677 TTCTGCCAGTGCAGGTTCCTGGG - Intergenic
1151150668 17:72083357-72083379 ATGTGTCAGTGCAGGCCCATTGG + Intergenic
1167497549 19:49828435-49828457 CTCTGCCCCTGCAGGTTCATGGG + Exonic
926657284 2:15421947-15421969 ATGTGTCAGTGCACGTTCATGGG - Intronic
927205916 2:20610187-20610209 ATGTGTCCATGTAGGTTCACTGG - Intronic
931951632 2:67370015-67370037 ATGTGCCAAGGCAGTTCAATGGG - Intergenic
932687628 2:73886475-73886497 ATGTGTCAATGTAGGTTCATTGG + Intergenic
933871692 2:86572691-86572713 ATGTGCAAATACAGTTACATTGG + Intronic
936966583 2:118133180-118133202 CTGTGGCTATGCAGGTTGATTGG + Intergenic
938719266 2:134051500-134051522 ATGTGTCAATGTAGGTTCACCGG + Intergenic
939084317 2:137699174-137699196 ATGCACCAATGCAGTTTAATGGG - Intergenic
940110880 2:150152355-150152377 ATGTGTCAACATAGGTTCATCGG - Intergenic
940186074 2:150986000-150986022 CTGTGCCAAGGCAGTTTCCTTGG - Intergenic
946975757 2:225148365-225148387 ATTGGCCAAAGCATGTTCATAGG - Intergenic
1169535971 20:6540849-6540871 ATGTGCCAATGTACGTGCCTGGG - Intergenic
1171433053 20:25098322-25098344 ATGTACCAATATTGGTTCATTGG + Intergenic
1176889138 21:14293324-14293346 ATGTGTCAATGTGGTTTCATCGG + Intergenic
1177369945 21:20189417-20189439 ATGTTCCACTTCAGGTTCATGGG + Intergenic
1180678582 22:17606756-17606778 ATTTGCCAGAGCAGTTTCATTGG - Intronic
1184487866 22:44791925-44791947 ACATTCCAATGCAGGTGCATTGG + Intronic
951395708 3:22164032-22164054 ATGTGCCTTTGCAGGCTTATTGG - Intronic
951679595 3:25281041-25281063 AAATGCAAATGCAGTTTCATAGG - Intronic
953230014 3:41056119-41056141 TTGTGACAATGCAGATTCCTAGG + Intergenic
954438455 3:50508546-50508568 ATGGCCCAATGCTGGTTTATGGG - Intergenic
955769874 3:62375927-62375949 AAATGGCAAGGCAGGTTCATGGG - Intergenic
959485119 3:106919818-106919840 ATGTGTCAACGTAGGTTCAATGG + Intergenic
962352533 3:134666303-134666325 ATGTGCAAATGCAGGTGCCTGGG + Intronic
963297545 3:143562353-143562375 ATTTGGGAGTGCAGGTTCATGGG + Intronic
966485170 3:180460746-180460768 TTGTGTCAGTGTAGGTTCATTGG - Intergenic
967151646 3:186656308-186656330 ATGTGTCAGTGTAAGTTCATCGG + Intergenic
970295029 4:14620183-14620205 AGGGGCCAATGCAGGTGCTTGGG - Intergenic
972748433 4:41964352-41964374 ATGTGCCCATGAATGTTCTTTGG + Intergenic
972764427 4:42139251-42139273 ATGTGCTAATGCTATTTCATTGG + Intronic
978524110 4:109647167-109647189 GTGTACCAATGAAGGTTTATAGG - Intronic
979515097 4:121598606-121598628 ATGTATCAGTGCAGGTTCATTGG + Intergenic
980503065 4:133682087-133682109 ATGTGCCAATGGTGATTGATTGG + Intergenic
983160526 4:164408333-164408355 ATGACCCCATGCAGTTTCATTGG + Intergenic
984404590 4:179311566-179311588 ATGTGCTAATGTAAGTTCATTGG - Intergenic
986255579 5:6100384-6100406 ATGTGATAAGGGAGGTTCATGGG - Intergenic
987194611 5:15513670-15513692 AGATGTCAATGCAGATTCATAGG + Intronic
990216304 5:53536152-53536174 ATATGTCAATGTAGGTTCATCGG + Intergenic
991469990 5:66957709-66957731 ATGGGCCAGTGGAGGTTTATAGG - Intronic
992060551 5:73041294-73041316 ATGTCCTGATGCAGATTCATTGG + Exonic
994260107 5:97648008-97648030 ATGTATCAATGTTGGTTCATAGG - Intergenic
996458515 5:123713397-123713419 GTGTGTCAATGTTGGTTCATTGG - Intergenic
999564674 5:152844386-152844408 ATGTGGCAATGTAGATTCATTGG - Intergenic
1000046919 5:157529673-157529695 GTGTGCCACTGCAAGTTCCTAGG + Intronic
1010372107 6:75122341-75122363 ATGTGTCAATGTAGGTTCATCGG + Intronic
1010686539 6:78860016-78860038 ATGTGTTAATATAGGTTCATTGG - Intergenic
1010715282 6:79221867-79221889 ATGTACCAATGAAGGTTTTTTGG - Intronic
1012334684 6:98040563-98040585 ATATGCCAATCCAGGCACATGGG - Intergenic
1012469704 6:99557307-99557329 CTGTGCCAATGCAGTGGCATTGG - Intronic
1014156272 6:118113402-118113424 ATGTGTCAATGTAGGTTCACTGG + Intronic
1014478974 6:121911744-121911766 ATGTGCCAGTACAGGTACAGTGG + Intergenic
1016232712 6:141826287-141826309 ATGTGTTAGTGCAAGTTCATCGG - Intergenic
1020544739 7:9512799-9512821 ATGTGTCCATTTAGGTTCATTGG - Intergenic
1023224216 7:37952298-37952320 CAGTGCCCATGCAGGTTCCTGGG + Intronic
1025073208 7:55919376-55919398 ATGTGCCAATGCAGTCTCACAGG + Intronic
1026884161 7:73928380-73928402 ATGTATTAATGTAGGTTCATGGG - Intergenic
1027571501 7:79873861-79873883 CTGTACCAATGCAGGTTTGTGGG + Intergenic
1029603318 7:101582891-101582913 ATGTACAGATGCAGGTTCAGAGG - Intergenic
1030365335 7:108639490-108639512 ATGTGTCAATGTAGGTTCACCGG - Intergenic
1031116150 7:117670896-117670918 ATGTGTCAATGTAGGTTCATTGG - Intronic
1031505391 7:122575955-122575977 ATGTGCCAATGTAAGTTTCTTGG - Intronic
1032174173 7:129610729-129610751 ATGTGAAAATGCAGGTTCCTAGG + Intergenic
1034915162 7:155032875-155032897 ATGTGTCAATGTAGGTTCAGTGG - Intergenic
1037684351 8:21125821-21125843 ATGTGCATGTGCAGGCTCATGGG - Intergenic
1038630229 8:29235190-29235212 TTGTGTCAATGCTGTTTCATTGG - Intronic
1039940945 8:42090652-42090674 GTGTGTCAATGTAGGTTCATGGG + Intergenic
1039999852 8:42566647-42566669 ATGGACCATTGCAGGTTCTTGGG - Intergenic
1040649290 8:49431194-49431216 ATATACCAATGGAAGTTCATTGG + Intergenic
1040998741 8:53428317-53428339 ATGTATCAATTCAGGCTCATTGG + Intergenic
1041285173 8:56253079-56253101 AGGTGCCAATTCTGGTGCATGGG - Intergenic
1041334408 8:56763936-56763958 ATGTGTTAATGTAGGTTCATGGG - Intergenic
1042475185 8:69239896-69239918 ATTTGTCAATACATGTTCATTGG - Intergenic
1042891281 8:73613547-73613569 ATGTACAAATGCAGGTGCACAGG + Intronic
1043866908 8:85385162-85385184 ATGTGCAAATTGAGGTTCAGAGG + Intronic
1044078345 8:87852304-87852326 ATGTGTCAATGTAGGTTCATAGG + Intergenic
1045931706 8:107634503-107634525 ATGTGTCAATGTAGGTTTATTGG - Intergenic
1046209750 8:111054263-111054285 ATCTTCCAATGCATGTACATGGG + Intergenic
1046574473 8:116009109-116009131 ATGTGTCAATGTAAGTTCATCGG + Intergenic
1046964852 8:120152602-120152624 TTGAGCCAATGTAGGTTCACAGG - Intronic
1047310350 8:123686678-123686700 CTGTTACAATGCAGGTTCCTGGG - Intronic
1050063795 9:1737775-1737797 AAGTGTCAATGCAGGTTCTCAGG + Intergenic
1053591453 9:39518476-39518498 ATCTGCAAATGCAGATTCATGGG + Intergenic
1053849297 9:42273835-42273857 ATCTGCAAATGCAGATTCATGGG + Intergenic
1054574854 9:66846813-66846835 ATCTGCAAATGCAGATTCATGGG - Intergenic
1056104274 9:83331601-83331623 ATGTATCAATGTAGGCTCATCGG + Intronic
1057242170 9:93420840-93420862 ATGTGTTAATGTAGGTTCATCGG - Intergenic
1060718267 9:125955103-125955125 ATGTGCCTGTCCAGGGTCATTGG - Intronic
1186279951 X:7981315-7981337 ATGTGTCAATGTAAGTTCATGGG - Intergenic
1186794733 X:13034172-13034194 ATATGTCAATGTAAGTTCATGGG + Intergenic
1187213820 X:17255123-17255145 ATTCCCCAATGCAAGTTCATTGG - Intergenic
1188043763 X:25401990-25402012 ATATGTCAATGTAGGTTCATCGG - Intergenic
1188843911 X:35050100-35050122 ATGTGCCACTCCAGGTTTTTTGG - Intergenic
1189962855 X:46341064-46341086 TTATTCCAATGCAGGGTCATAGG + Intergenic
1190617673 X:52252861-52252883 ATGTGTCAAAGTAGATTCATTGG - Intergenic
1190969745 X:55337014-55337036 ATGTGCCATGGCAGAGTCATGGG + Intergenic
1198245271 X:134824989-134825011 ATGTGCCAATGCAGGTTCATTGG + Intronic
1199532324 X:148864046-148864068 ATGTGGCACTGCGTGTTCATTGG + Intronic
1199935587 X:152570312-152570334 ATGTGCCAATTTGGGTTCTTTGG + Intergenic
1201403629 Y:13629473-13629495 AGGGGCCATTGCAGGTTCTTGGG + Intergenic