ID: 1198248079

View in Genome Browser
Species Human (GRCh38)
Location X:134850951-134850973
Sequence TTATTGTATCTGGCCAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198248079_1198248081 15 Left 1198248079 X:134850951-134850973 CCATTTTTGGCCAGATACAATAA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1198248081 X:134850989-134851011 TGAAATTTATTCATATATTTTGG 0: 1
1: 3
2: 14
3: 173
4: 1214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198248079 Original CRISPR TTATTGTATCTGGCCAAAAA TGG (reversed) Intronic
901164697 1:7210147-7210169 TTATTGTATTTTGCTAATAAAGG - Intronic
901570567 1:10156830-10156852 TTTTTGTGTGTGACCAAAAAAGG - Intronic
905117785 1:35657306-35657328 TAATAGTATCTGCCCCAAAAGGG + Intergenic
905127293 1:35724642-35724664 TTATTTTATTTAGCCCAAAAAGG - Intronic
906217000 1:44047902-44047924 TTACTGGATGTGGCCAATAAAGG + Intergenic
907992579 1:59597103-59597125 ATTTTCTATCTGGCCAGAAATGG + Intronic
909115035 1:71522841-71522863 TTATTGTATCTGGCTCAACAGGG - Intronic
909273692 1:73657267-73657289 TAATTGTACTTGGCCAAAGAAGG + Intergenic
909303460 1:74042727-74042749 TAATTTTGTCTGTCCAAAAAAGG - Intronic
909544454 1:76829880-76829902 TTATTATATATGGCATAAAATGG - Intergenic
910916017 1:92290006-92290028 TTATAGTATCTGGCCAGAGTGGG - Intronic
915007614 1:152654567-152654589 TTATTGTTTCTGTCAAAATAAGG + Intergenic
917320548 1:173776592-173776614 TTTTTGTATATGGCAAAAAATGG + Intronic
918114774 1:181486149-181486171 TCCTTGTCTTTGGCCAAAAATGG + Intronic
918532659 1:185540208-185540230 TTACAGTATATGGCCTAAAAAGG - Intergenic
918706428 1:187668470-187668492 TTATTGGAAGTAGCCAAAAATGG - Intergenic
920327887 1:205181063-205181085 TTATTTTATGTGGCAAAAAAAGG - Intronic
921038071 1:211401761-211401783 TTTTTGTATCTGGCAAGAGATGG + Intergenic
924186040 1:241492155-241492177 TTACTTTATATGGCCAAAAAGGG + Intergenic
1063735816 10:8753128-8753150 TTCTTGTGTCTGGCCAGAAGTGG + Intergenic
1063861099 10:10308348-10308370 TTTTTGTATCTGGCCTGCAAAGG - Intergenic
1065441910 10:25761815-25761837 TTACTGTATATGGTCTAAAAAGG - Intergenic
1066619345 10:37327370-37327392 TTATTTTATCTGGACATAAAAGG + Intronic
1069040669 10:63692551-63692573 ATATTGTGTGTGGCCAAAGAAGG - Intergenic
1071674653 10:87644152-87644174 TTATTGTTTCTGGCCACTCATGG + Intergenic
1074120617 10:110491571-110491593 TTTTTGAATGAGGCCAAAAAAGG - Intergenic
1075141776 10:119843950-119843972 TTATTGTTTCTGGCCAGGCATGG - Intronic
1075847552 10:125557040-125557062 TTATAGTATCTGCCGACAAATGG + Intergenic
1077909295 11:6560005-6560027 TTCTTATATCTGGCTAAAATTGG + Intronic
1077979829 11:7288461-7288483 CTAATGTATCAGGCCCAAAAGGG - Intronic
1078417190 11:11175453-11175475 TTACTTTATGTGGCCAAAAAGGG + Intergenic
1079157783 11:17964507-17964529 TGACAGTATCTGTCCAAAAAGGG + Intronic
1079658998 11:23017379-23017401 TCTCTGTATCTGGGCAAAAAAGG + Intergenic
1080717825 11:34821071-34821093 TTATAGCATCTGGCCGAAAGTGG - Intergenic
1081395156 11:42578209-42578231 TTTTAGTTTCTGTCCAAAAAGGG - Intergenic
1084143767 11:67252171-67252193 TTACTGTATCAGGTCAAAAGAGG - Intronic
1086026794 11:82303245-82303267 TTATTGTATGTGTCAAAAATGGG + Intergenic
1088447130 11:109943665-109943687 TTTTTGTATTTGGCCTAAGAGGG - Intergenic
1088712596 11:112521973-112521995 TTACTTTATATGGCAAAAAAAGG + Intergenic
1090857112 11:130619794-130619816 GTATTGTACCTGGCCAATAGTGG - Intergenic
1091519759 12:1226153-1226175 ATATTGAAGATGGCCAAAAATGG + Intronic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1097012504 12:55963284-55963306 TTATTGTAACTGACCAAGAGAGG + Intronic
1098057987 12:66528556-66528578 TTATTGTAGCTTTCTAAAAATGG - Intronic
1098924628 12:76335967-76335989 TGATTGAATATGTCCAAAAAAGG - Intergenic
1100227540 12:92574213-92574235 TGCTTGTATCTGCCCACAAAAGG + Intergenic
1102342804 12:112136878-112136900 CTATGGCATCTGGCCAAAACTGG + Intronic
1103693691 12:122796817-122796839 TTATTCTATCTCCCCACAAAAGG + Intronic
1106909741 13:34450856-34450878 TTATTAAATCTGGTCAGAAAAGG - Intergenic
1110886246 13:80639881-80639903 TTATTTTATATGGTGAAAAAGGG - Intergenic
1111061718 13:83028728-83028750 TTTTTGTATATGACCACAAAAGG + Intergenic
1111090019 13:83433248-83433270 ATATGGTTTCTGGCCAAAGATGG + Intergenic
1114995527 14:28346894-28346916 TTATTGAATGTGGCAAAAAAGGG - Intergenic
1116273507 14:42801989-42802011 TTATTATCACTGGCAAAAAAAGG + Intergenic
1116410399 14:44614810-44614832 TTCTTGTCACTGGCCAAAAGAGG + Intergenic
1118126262 14:62908135-62908157 TCATTTTATTTGACCAAAAAAGG + Intronic
1119614963 14:76092920-76092942 TTTTTGCACGTGGCCAAAAAAGG + Intergenic
1120372451 14:83653811-83653833 CTAATGTATGAGGCCAAAAATGG + Intergenic
1121496703 14:94396990-94397012 TTACTGTATATGGTCTAAAAAGG + Intergenic
1124196311 15:27633405-27633427 TTATTCTAAATGGCCAAATAGGG + Intergenic
1126773961 15:52083791-52083813 TTATAGTATTTGGACAACAAGGG - Intergenic
1129685414 15:77683640-77683662 TTATTGTGTATTGCTAAAAAAGG - Intronic
1134866550 16:17612357-17612379 TTTTTGGATCTGGCCCAAGAGGG - Intergenic
1137311659 16:47266855-47266877 AAATTCTATTTGGCCAAAAAAGG + Intronic
1137496361 16:48972091-48972113 TTTTTTTATCTGGCCATAAAGGG + Intergenic
1138062684 16:53908486-53908508 TTCTTATATCTGGCAAAAGAAGG - Intronic
1138190949 16:55013797-55013819 CCACTGTACCTGGCCAAAAAAGG - Intergenic
1138980295 16:62259603-62259625 TTATTCTATATGGTCTAAAAAGG + Intergenic
1139076065 16:63449844-63449866 ATATTATATTTGGCCTAAAAAGG - Intergenic
1142053024 16:87972816-87972838 TCAATGTATTTGGCCTAAAAGGG + Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1150750651 17:67858868-67858890 GGTCTGTATCTGGCCAAAAAGGG - Intronic
1150793137 17:68215861-68215883 GGTCTGTATCTGGCCAAAAAGGG - Intergenic
1150899367 17:69254388-69254410 ATGTAGTATCTGGCCACAAAGGG + Exonic
1151111385 17:71682119-71682141 TTATTCTATTTGGGGAAAAAGGG + Intergenic
1153264789 18:3259593-3259615 TTATTTTTTCTGTCCATAAAGGG + Intergenic
1153437156 18:5079681-5079703 ATCTTGTATCTGGCCAATGATGG - Intergenic
1155328999 18:24695251-24695273 ATTTTGTAACTGGCAAAAAAAGG + Intergenic
1157094810 18:44678729-44678751 TTTTTGTATTTGGCCTACAAAGG - Intergenic
1157417162 18:47513384-47513406 TTTTTCTATCTGTTCAAAAATGG + Intergenic
1158231786 18:55264621-55264643 TTAATGTATCTTGCTAAACATGG - Intronic
1158268560 18:55687235-55687257 TTATTGCATCTGCTCAAAATGGG - Intergenic
1159187332 18:64992181-64992203 TTATTGTATCAGCCTCAAAATGG - Intergenic
1159677083 18:71298420-71298442 TTATTCTATCTTACCAAAAAGGG - Intergenic
1160084425 18:75761848-75761870 ATATTCTATGTGGCCAAAAGTGG - Intergenic
1164747268 19:30625709-30625731 TTACTGTTTCTGTCCAGAAACGG - Intronic
1166122845 19:40695727-40695749 TTACTTCATCTGGCCTAAAACGG + Intronic
1166822670 19:45590245-45590267 TTAATTTATCTGGCCAGACATGG + Exonic
1167167614 19:47809965-47809987 TCATTGCGTCTGGCCAAGAATGG - Intronic
925672213 2:6323363-6323385 TTTTTGTATATGCCCAATAATGG - Intergenic
927194082 2:20535859-20535881 TTGTTGTTTCTGGCCAGAATTGG - Intergenic
927777404 2:25912928-25912950 GCATTGTATCTGGAAAAAAAGGG - Intergenic
929264301 2:39900974-39900996 TTATTATTTCTACCCAAAAATGG - Intergenic
930715088 2:54586300-54586322 TTATGGTCACTGGCCAAAAAGGG + Intronic
930783532 2:55247852-55247874 TGATGGTATCTGGCCAGAAAAGG + Intronic
931599284 2:63987232-63987254 TTTTTGTATATGGCGAAATAGGG + Intronic
935240862 2:101177016-101177038 CTATTGTATCTGGTCTAAAAGGG - Intronic
938692601 2:133806103-133806125 TAATTGTATATGAGCAAAAATGG + Intergenic
940236806 2:151520270-151520292 TTATTAAACTTGGCCAAAAATGG + Intronic
940710117 2:157152738-157152760 GGATTTTATCTGGCCCAAAATGG + Intergenic
943413936 2:187575011-187575033 TTCTTAAATCTTGCCAAAAACGG - Intergenic
945462245 2:210122498-210122520 TTTTTGTATATGGCAAGAAATGG - Intronic
1169579699 20:7006141-7006163 TTTTTGTATATGGTAAAAAAGGG - Intergenic
1169884460 20:10383077-10383099 TGATTCTATCTGGGCAAAAAAGG - Intergenic
1170017272 20:11795943-11795965 TTATTCTATCTGGCAGGAAATGG + Intergenic
1170247811 20:14243454-14243476 TAATGGCATCTAGCCAAAAAAGG - Intronic
1170568299 20:17618922-17618944 TGATTATCTCTGGCAAAAAAGGG + Intronic
1171079684 20:22166091-22166113 ATATTTTATTTGGCTAAAAACGG + Intergenic
1172691137 20:36790860-36790882 CCATTGCACCTGGCCAAAAAAGG + Intronic
1172832086 20:37844621-37844643 CCATTGTGTCTGGCCCAAAAGGG - Intronic
1175268764 20:57719085-57719107 TTATTGTATCTCCTCTAAAAGGG + Intergenic
1177257212 21:18680595-18680617 TTATTTTTTCTTGTCAAAAAAGG - Intergenic
1177570830 21:22884273-22884295 TTCTTGTATCTTTACAAAAATGG + Intergenic
1177867945 21:26535397-26535419 TTGTTGAATGTGGGCAAAAAGGG + Intronic
1177911716 21:27041214-27041236 TTATCCTATATGGTCAAAAAGGG + Intergenic
1177953771 21:27570941-27570963 TTATAGTTTCTTGCCAAAGATGG + Intergenic
1178465860 21:32847091-32847113 TTATTTTATCTGTACAAAATGGG - Intergenic
1183874483 22:40767323-40767345 TTGTTGTATCTTCTCAAAAAAGG - Intergenic
949300588 3:2579205-2579227 GTATTGTATCTAGAAAAAAATGG + Intronic
953768964 3:45764280-45764302 TTATTGTATAGGCACAAAAAGGG + Intronic
956629999 3:71307195-71307217 TTACTGTATTTGGACTAAAAAGG + Intronic
957001065 3:74885390-74885412 TTATTGTAACAGCCCAAAACTGG - Intergenic
957143438 3:76391277-76391299 TTATCGTATTTTGCTAAAAATGG + Intronic
959533165 3:107456531-107456553 TTTTTTTATCTTGCCAAATAGGG - Intergenic
960133547 3:114083524-114083546 TTTTTGTATTTGTCCAAAAGTGG + Intronic
961502382 3:127345925-127345947 TAAATGTAACTGACCAAAAATGG + Intergenic
961543450 3:127616368-127616390 TAATTGTAAATGGCCACAAAGGG - Intronic
962101039 3:132343130-132343152 GTAATTTATCTGGCCACAAACGG - Intronic
964538572 3:157754096-157754118 TGATTGTATCTGGCAAAACCAGG + Intergenic
964573450 3:158138049-158138071 TAATTGTATCTGGGCAACAAAGG - Intronic
964692958 3:159473609-159473631 TTATTGAATTTGGGCAAGAAGGG + Intronic
965005904 3:163022842-163022864 TTCTTGTATCTTGGAAAAAATGG + Intergenic
966057193 3:175708722-175708744 TTTTTGTTTCTGGCCCTAAATGG - Intronic
967742609 3:193019876-193019898 CCATTGAAGCTGGCCAAAAATGG + Intergenic
968344448 3:197989412-197989434 TTTTTGTATGTGGTGAAAAAGGG + Intronic
969544619 4:7817290-7817312 TTATTTTAGATGGCCAAAAAAGG + Intronic
970354156 4:15235825-15235847 TTATTGTGTCAAGCCACAAAGGG - Intergenic
971123854 4:23731018-23731040 TTATCATAGCTGCCCAAAAAAGG + Intergenic
971504613 4:27352766-27352788 TTATTGTTTCTGGCAATGAAGGG + Intergenic
974684671 4:65211719-65211741 TTTTTGTATCTAGACAAAAGTGG - Intergenic
977026189 4:91821768-91821790 TTACTGTATTCGTCCAAAAATGG - Intergenic
977081352 4:92532663-92532685 TTAGAGTATGTGGTCAAAAAAGG + Intronic
977225906 4:94391422-94391444 TGATTTTATCTGGGCTAAAAGGG + Intergenic
977266418 4:94861427-94861449 TGTTTGTATTTGGCCAAGAATGG + Intronic
977328097 4:95602665-95602687 TTATTTTATGTGGGGAAAAAAGG + Intergenic
979488921 4:121301761-121301783 TTATTTTATGTGCCCTAAAAGGG + Intergenic
980271761 4:130593294-130593316 TTTTTGGATCTGGACAAAGAAGG - Intergenic
981660455 4:147160082-147160104 TTATTGTCTCTAGTCAAGAAGGG - Intergenic
982322180 4:154088601-154088623 TTGTGGTATTTGGCCAAAGATGG - Intergenic
983643766 4:169969164-169969186 TTATTGTCTCTGTGCAAAACTGG - Intergenic
984806186 4:183754081-183754103 TTATTGAATCCCGACAAAAAAGG - Intergenic
985883143 5:2656094-2656116 TTTTTGTAGCTGCTCAAAAAAGG - Intergenic
986052735 5:4105172-4105194 TTATTTTATATGGCAAAAAAGGG - Intergenic
989184603 5:38611051-38611073 TTATTGTATCTTTCTAAAAGAGG - Intergenic
989445874 5:41527680-41527702 TTACTTTATTTGGCCTAAAAAGG + Intergenic
990553851 5:56910127-56910149 AGCTTGTATCTGGGCAAAAATGG + Intronic
992566838 5:78004544-78004566 TGATTTTATTTGTCCAAAAATGG - Intronic
993681949 5:90889617-90889639 TATTTTTATCTGACCAAAAAAGG - Intronic
994011377 5:94906659-94906681 TCATTATATATGACCAAAAATGG + Intronic
994668205 5:102733258-102733280 TTTTTGTATCTGCACAAACAAGG - Intergenic
994807447 5:104468719-104468741 TTATACTATCAGGCCAAAACTGG - Intergenic
995515044 5:112946024-112946046 TTTTTGTATATGGCAAAAGATGG - Intergenic
997381657 5:133442529-133442551 TTATTGACTCTGGTCAAAAACGG - Intronic
1002951838 6:1821200-1821222 TTCTTGTCTCTCGGCAAAAATGG + Intronic
1007372412 6:41434821-41434843 TTAATGTATCAGGCCAACCATGG - Intergenic
1010045246 6:71434899-71434921 ATACTGTATGTGGCCTAAAATGG - Intergenic
1010639954 6:78312760-78312782 ATACTGTATATGGTCAAAAATGG + Intergenic
1010849734 6:80758096-80758118 TTATATTATGTGGTCAAAAAAGG + Intergenic
1014616657 6:123609876-123609898 CTACTGTATCTAGCTAAAAAAGG + Intronic
1014818730 6:125961798-125961820 TTAATGTGACTGGACAAAAAGGG + Intronic
1017189882 6:151641885-151641907 TTTTTGGATCTGGTCTAAAAAGG + Intergenic
1017553080 6:155531327-155531349 TCTTTCTATCTGGCCCAAAATGG + Intergenic
1018305768 6:162453610-162453632 TAATAGTATCTGGCCAGACACGG + Intronic
1018776865 6:167025195-167025217 TCATTGTAAATGTCCAAAAAAGG - Intronic
1020195122 7:6031884-6031906 CTACTGCGTCTGGCCAAAAAAGG - Intronic
1020726176 7:11818249-11818271 TTATGGTATGTGGCCAATACAGG - Intronic
1021410369 7:20323352-20323374 TTATAGTATCTTTCAAAAAAGGG + Intergenic
1021715451 7:23457891-23457913 ATGTTGTATCTGAACAAAAAAGG + Intronic
1026562336 7:71460766-71460788 TTACTCTATATGGCCTAAAAAGG - Intronic
1026808460 7:73442897-73442919 TAAGTGTATCTGCTCAAAAAAGG + Intronic
1029011592 7:97267692-97267714 TTATGATATGTGGTCAAAAAAGG + Intergenic
1029662141 7:101969686-101969708 TTCTTTGATCTGGCCAAAAGAGG - Intronic
1030488354 7:110200031-110200053 TTTTTGTATGTGGCCAGAGATGG + Intergenic
1031275855 7:119722600-119722622 TTAATATATCTTGACAAAAATGG - Intergenic
1031812115 7:126383571-126383593 CAATTGTACCTGGCCAAAAATGG - Intergenic
1033189622 7:139265549-139265571 TTATTTTATATGGCAAAAGAAGG + Intronic
1035762891 8:2082472-2082494 TTACTGTTGCTGGCTAAAAATGG + Intronic
1035986118 8:4433817-4433839 TTAATGAATCTGGAAAAAAAGGG + Intronic
1036791510 8:11724317-11724339 TTATGGTATATGCCCAAAAGCGG + Intronic
1039499435 8:38004959-38004981 TTACTGTATATGGCCTAAAAAGG - Intergenic
1040642504 8:49354902-49354924 TTATTGAATCTCCCTAAAAAAGG - Intergenic
1041870094 8:62624005-62624027 TTACTGTATATGGTCTAAAAGGG - Intronic
1042417437 8:68539559-68539581 TTATTGTAGTTGGCCAAGCACGG + Intronic
1043499992 8:80843796-80843818 TTATTATCTCTGGGGAAAAAAGG - Intronic
1044636553 8:94330966-94330988 TTCTTTTTTCTGTCCAAAAATGG + Intergenic
1044921480 8:97174054-97174076 TAATTATATCTGGGCAAAACTGG - Intergenic
1045916940 8:107482968-107482990 ATTTTGTATCTGACCAGAAAAGG + Intronic
1046658772 8:116925819-116925841 TTCTCATATCTGGCCAGAAAAGG - Intergenic
1046715300 8:117560372-117560394 TAAGTGTGTCTGGCCACAAAAGG - Intergenic
1046751424 8:117931006-117931028 TTATCTTATATGGCCTAAAAAGG + Intronic
1047133535 8:122050350-122050372 TTATTTTATTTGGGAAAAAATGG - Intergenic
1047938912 8:129808481-129808503 TTATTGTATTTTGCCATAGAAGG + Intergenic
1048392951 8:133985558-133985580 TTATTTGAGCTGTCCAAAAATGG + Intergenic
1050710729 9:8459803-8459825 TTCGTGTATGTGTCCAAAAAGGG - Intronic
1050745277 9:8868929-8868951 GTATTGTATTTGGATAAAAAGGG - Intronic
1054355538 9:64057842-64057864 TCAATGTAACTGTCCAAAAATGG - Intergenic
1056158792 9:83867041-83867063 TTTTTGTCTCTGGACAGAAATGG + Intronic
1056351775 9:85756897-85756919 TTTTTGTCTCTGGACAGAAATGG - Intergenic
1056702742 9:88924479-88924501 TTCTTGTTTCTGACCAAAAAAGG - Intergenic
1057009332 9:91587973-91587995 CCACTGTACCTGGCCAAAAATGG - Intronic
1058584199 9:106489309-106489331 TTATTGTTTCAGGCCAAGCACGG + Intergenic
1059963764 9:119593174-119593196 TGATTGCATCTGCCCAAATAAGG - Intergenic
1061348528 9:130045041-130045063 TTATTGTAACTGCCCAACAAAGG - Intergenic
1061586128 9:131569956-131569978 TTATTCACACTGGCCAAAAAGGG - Intergenic
1185795421 X:2960364-2960386 TAATTGTATCTTACCAAGAATGG + Exonic
1187569403 X:20485738-20485760 TCATTGTATCATGCCAAAATTGG + Intergenic
1187909215 X:24094806-24094828 TTATTGTAACAGGCAATAAATGG - Intergenic
1189649136 X:43170347-43170369 TTATTGTATGCGAGCAAAAATGG - Intergenic
1190815100 X:53922930-53922952 TTACTGTATATGGTCTAAAAAGG + Intergenic
1194751001 X:97683769-97683791 TTCTTTTATTTGACCAAAAAGGG - Intergenic
1194992623 X:100561409-100561431 TTATTGTTTCTGGCAGAGAAGGG + Intergenic
1195070670 X:101276332-101276354 TTATTGAATCTGGCCAGTATAGG - Exonic
1195201554 X:102554941-102554963 TTTTTGTATCTTTCAAAAAATGG + Intergenic
1195277758 X:103299004-103299026 TTATTGTTTGTGGTCATAAATGG - Intergenic
1195751734 X:108166117-108166139 TTATTCTCTTTGGCCAAAAAGGG - Intronic
1196334282 X:114512827-114512849 TTTTTATATCTGGCAAAAAATGG + Intergenic
1196375759 X:115030871-115030893 TTATTGCATGAGGCCAACAAGGG - Intergenic
1196994645 X:121368810-121368832 TTTTTGTATATGGCAAGAAATGG - Intergenic
1198248079 X:134850951-134850973 TTATTGTATCTGGCCAAAAATGG - Intronic
1198392364 X:136189121-136189143 TTATTGACTCTAGCCAGAAAAGG + Intronic
1198650357 X:138856820-138856842 GTATTTCATCTGGCCAGAAATGG - Intronic
1198891337 X:141400645-141400667 ATTTTGTATCTGGCCAAACTAGG - Intergenic
1199404576 X:147442213-147442235 TTATTCTATATGGTCTAAAAAGG + Intergenic
1200779994 Y:7206071-7206093 TTATTGAATCTGGCCATTTAGGG + Intergenic
1201338875 Y:12909814-12909836 TTATTGGATGTGGCCAAAAGTGG - Intronic