ID: 1198251533

View in Genome Browser
Species Human (GRCh38)
Location X:134883748-134883770
Sequence GGATATGAGTACATAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198251533_1198251536 5 Left 1198251533 X:134883748-134883770 CCAATAGCTATGTACTCATATCC No data
Right 1198251536 X:134883776-134883798 AAAATCCATCTTGGCCCCGCAGG No data
1198251533_1198251537 8 Left 1198251533 X:134883748-134883770 CCAATAGCTATGTACTCATATCC No data
Right 1198251537 X:134883779-134883801 ATCCATCTTGGCCCCGCAGGTGG No data
1198251533_1198251534 -4 Left 1198251533 X:134883748-134883770 CCAATAGCTATGTACTCATATCC No data
Right 1198251534 X:134883767-134883789 ATCCTTTACAAAATCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198251533 Original CRISPR GGATATGAGTACATAGCTAT TGG (reversed) Intergenic
No off target data available for this crispr