ID: 1198251945

View in Genome Browser
Species Human (GRCh38)
Location X:134887857-134887879
Sequence CCTCACATGGTTAAACAGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198251942_1198251945 -4 Left 1198251942 X:134887838-134887860 CCGTTTAATGACTTAGGCTCCTC 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1198251945 X:134887857-134887879 CCTCACATGGTTAAACAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198251945 Original CRISPR CCTCACATGGTTAAACAGTG AGG Exonic
903561908 1:24234374-24234396 CCTCCCACAGTTATACAGTGAGG + Intergenic
907690714 1:56662680-56662702 ACTGACATGGTTAAACTCTGAGG - Intronic
907881803 1:58556501-58556523 CCTCACTTGGTAAAACTCTGTGG - Intergenic
909858438 1:80572298-80572320 CCTCACATGTTGAAAGAATGAGG + Intergenic
912306504 1:108573096-108573118 CCTCATTTGGTTAAACACTGAGG + Intronic
918169654 1:181984576-181984598 CCTCACATGGATCAAAAGTTTGG + Intergenic
918220311 1:182430621-182430643 CCTCTCATGGTGATACATTGAGG + Intergenic
918728339 1:187954915-187954937 CCTCACAAGGTTTTAAAGTGTGG + Intergenic
921247348 1:213258474-213258496 CTTCACATAATTTAACAGTGTGG + Intronic
921356704 1:214291344-214291366 CCCAACATGGTTAAACATTCTGG - Intronic
921857629 1:220004141-220004163 CCTCACCTGCTTGAGCAGTGAGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1064731832 10:18339097-18339119 CCTCACATGAGTACACAGGGAGG - Intronic
1065022774 10:21514631-21514653 GGTTACATGGTTACACAGTGAGG - Exonic
1068094475 10:52473116-52473138 CCTCACATGGTTGAGCAGTGGGG + Intergenic
1070104617 10:73419658-73419680 CCTCAAACAGTTAAACATTGAGG - Intergenic
1070583572 10:77743474-77743496 CCTCACATGGTAAAGGGGTGAGG - Intergenic
1072585974 10:96782348-96782370 CCTCAAAAGGTTAAACATAGAGG + Intergenic
1076372142 10:129962753-129962775 CTTCACATGATTAACCGGTGGGG - Intronic
1077101754 11:825592-825614 CCTCACACGGTGACACAGTGGGG + Intergenic
1080310221 11:30881477-30881499 CCTAAAGTGCTTAAACAGTGAGG + Intronic
1081520559 11:43877323-43877345 ACTCAAATGGTTACACACTGGGG - Intergenic
1082586091 11:54942553-54942575 CCTCACAGAGTTAAACAATTGGG - Intergenic
1084519610 11:69655423-69655445 CCTCCCAGGGCTCAACAGTGGGG + Intronic
1086863386 11:91951262-91951284 CCTCCCATGGGTAAGCAGGGAGG + Intergenic
1087489925 11:98812257-98812279 CCTCACATGGCAAAACAAAGGGG + Intergenic
1093203837 12:16222936-16222958 CCTTGCAGTGTTAAACAGTGAGG + Intronic
1095402250 12:41828161-41828183 CCCCACAACTTTAAACAGTGTGG + Intergenic
1098191722 12:67956233-67956255 CCTCACATGGTTGAAGAGACAGG - Intergenic
1102651529 12:114445879-114445901 CTTCATATGGATAAACAGTGAGG + Intergenic
1111783924 13:92763942-92763964 CCTCAGATGGTGGAACACTGTGG + Intronic
1112071519 13:95856309-95856331 CCTCACATGGCTAAAGAGTATGG - Exonic
1112366824 13:98762353-98762375 TCTCACATTGTTTAACACTGAGG + Intergenic
1112874789 13:104023954-104023976 CATCACATGGTGAAAGAGGGAGG + Intergenic
1114163802 14:20198294-20198316 TATCACAGGGTTAAGCAGTGGGG - Exonic
1114573834 14:23694769-23694791 CCTCACATTATTTAACACTGAGG + Intergenic
1114996242 14:28355669-28355691 CCCCAGATGGGTAAAAAGTGGGG + Intergenic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1118481025 14:66166037-66166059 CTTCACATGGTGATACAGTTGGG + Intergenic
1126697711 15:51340340-51340362 CCTCAGGTGCTGAAACAGTGTGG + Intergenic
1130692938 15:86101967-86101989 TCTCACATTGTTAATCATTGTGG + Intergenic
1131345174 15:91640160-91640182 CCTCACATGGTGGAAGGGTGAGG + Intergenic
1131817533 15:96236579-96236601 CCTCCCATGGCTAAACTGTCAGG - Intergenic
1132311415 15:100860652-100860674 CCACACCTGGATAAAAAGTGAGG + Intergenic
1138108527 16:54305087-54305109 CCTCCAATGGCTAAACAATGAGG + Intergenic
1138202225 16:55098244-55098266 CCACACTTGCTTAAACAGTAAGG + Intergenic
1138730004 16:59184104-59184126 CCTCACATGGTGGAAGGGTGAGG + Intergenic
1139032415 16:62900996-62901018 CCTGATATGGTAAAACAGTAAGG - Intergenic
1145305023 17:21669221-21669243 GCTTACATGGTTATGCAGTGGGG + Intergenic
1146774994 17:35606068-35606090 CCTCAGAAGGTAAAACAGTGGGG - Intronic
1147432159 17:40378632-40378654 CCTGACATGGTCAAACTGTTCGG - Intergenic
1151288388 17:73130206-73130228 CCACCCATGGCTAGACAGTGGGG - Intergenic
1151998931 17:77632586-77632608 CCTCACATGGTAGAAGGGTGGGG - Intergenic
1153386960 18:4509741-4509763 ACGCACGTGGTTAACCAGTGGGG + Intergenic
1153424034 18:4943672-4943694 ATTCACATGGATAAACACTGAGG + Intergenic
1155432909 18:25780276-25780298 CGTCACATGGTCAAGCAGTAAGG + Intergenic
1158151749 18:54382019-54382041 CCTCACATGAGTAAAGAATGTGG - Exonic
1160929770 19:1564929-1564951 CCACAGATGGTTCTACAGTGTGG + Intronic
1160965870 19:1746667-1746689 CCTCAAATGATTAACCAGTGCGG + Intergenic
1166394944 19:42432727-42432749 CCCCACTTTGGTAAACAGTGAGG + Intronic
925456598 2:4021678-4021700 CCTCACATGGTGGAAGAGTGGGG + Intergenic
929939443 2:46321735-46321757 CCTCACAGGTGTAAACAATGGGG - Intronic
929975064 2:46625751-46625773 CCTCTCATGCTTAATCAGTTTGG + Intergenic
931095631 2:58937594-58937616 CCTCATATGGTAGAACAGAGGGG + Intergenic
931593388 2:63911509-63911531 TCTCTCATGATTGAACAGTGGGG + Intronic
938619401 2:133032856-133032878 CTTCACATGGTGTACCAGTGGGG + Intronic
939215239 2:139228469-139228491 CCTCACCTGCTTAAATACTGTGG + Intergenic
939684993 2:145188411-145188433 CCTCACAAGGTGAAAGGGTGAGG + Intergenic
943896158 2:193363167-193363189 CCTGACATGGGAAAGCAGTGGGG - Intergenic
944646601 2:201786569-201786591 GGTCACATGGATAAACACTGAGG + Intergenic
945095734 2:206217296-206217318 CCTTACTTGGTTAAACTGTGAGG + Intronic
946735676 2:222752115-222752137 CCTCACATGGTGAAACGTTAAGG - Intergenic
1171530287 20:25848655-25848677 GCTTACATGGTTATGCAGTGGGG + Intronic
1176691874 21:9921988-9922010 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1178304992 21:31484063-31484085 CCTCACCTGGTAGAAGAGTGAGG - Intronic
1179306799 21:40161241-40161263 CATCACATGGCTAAACCGAGAGG + Intronic
1181269514 22:21651016-21651038 CCACACATAGGTAAGCAGTGAGG + Intergenic
1182425839 22:30271744-30271766 CCGCAAATGGTTAAACACAGAGG + Intergenic
1184854456 22:47138824-47138846 CCTCACACGGTGGAACAGGGAGG + Intronic
951530175 3:23691594-23691616 CCTCCCTGGGTTAAACACTGAGG - Intergenic
951544175 3:23808735-23808757 CCGCACAGGGCTAATCAGTGAGG - Intronic
961626161 3:128265101-128265123 GATCACATGGTTAACAAGTGGGG + Intronic
972140131 4:35948385-35948407 CCTCAGATGGTTGAAGACTGAGG - Intronic
975340441 4:73233736-73233758 CCTCACATGATAAAATAGAGGGG + Intronic
977477795 4:97535825-97535847 CCTCAGATGGAAAAGCAGTGGGG - Intronic
980342691 4:131570423-131570445 CCTGACATGGTTATATATTGAGG - Intergenic
980364460 4:131782191-131782213 CCTCACATGGTGGAAGAGGGAGG - Intergenic
982194008 4:152891063-152891085 CCTCACGTGGTGGAACAGGGAGG + Intronic
982222022 4:153132977-153132999 CCCCACAAGGTTAAACATAGAGG - Intergenic
983645734 4:169989646-169989668 CCTCAGATGGTGACAGAGTGAGG + Exonic
987722767 5:21659696-21659718 GATCACATGGTTACACAGAGGGG + Intergenic
998171243 5:139873070-139873092 CCCCACATGTCTAAACACTGAGG - Intronic
998880745 5:146642308-146642330 CCACAAATGGTTCATCAGTGTGG + Intronic
1002449844 5:179312416-179312438 CCTCACATGCTGAAAGGGTGAGG - Intronic
1002966403 6:1970680-1970702 CCTGAGATGGTTACAAAGTGTGG + Intronic
1004503601 6:16229901-16229923 CCTCACATTATTTAACACTGAGG - Intergenic
1005051698 6:21689985-21690007 CCTCACATGTTGAAATAATGAGG + Intergenic
1006989719 6:38204168-38204190 CCTCAGGTGGTTAAATAGAGAGG + Intronic
1007301961 6:40874448-40874470 CCTCACATGGCTCATAAGTGGGG + Intergenic
1009761878 6:68017457-68017479 TCTGACATTGTTAAACATTGGGG - Intergenic
1011756100 6:90499643-90499665 CCTCACATGGTACAAGGGTGAGG + Intergenic
1014479142 6:121913623-121913645 TCTCACATGTTTACAAAGTGGGG - Intergenic
1019703792 7:2487979-2488001 CCTCACCTGGAGAAACAGTCTGG + Intergenic
1019984726 7:4647387-4647409 CCTCAGATGGTCTAACAATGGGG + Intergenic
1020491448 7:8789340-8789362 CCTCATATGGTTAGCCAATGAGG + Intergenic
1021062462 7:16130933-16130955 CCTCACATGGTGGAAGGGTGTGG - Intronic
1021291481 7:18850860-18850882 CCTCACATGGTGGAAGGGTGAGG + Intronic
1025283022 7:57641898-57641920 GCTTACATGGTTATGCAGTGGGG + Intergenic
1025799126 7:64767923-64767945 CCTCACATGATTCTACAGTGAGG + Intergenic
1026508156 7:71004342-71004364 CCTCAGAGGGTTAAAAAGTATGG + Intergenic
1028006231 7:85572057-85572079 CGTCACATGGGTAAATTGTGTGG - Intergenic
1028682117 7:93547614-93547636 CCCCACATGGTTGACCTGTGTGG - Intronic
1040288889 8:46114264-46114286 CCTCACAAGCAAAAACAGTGTGG - Intergenic
1041799935 8:61787767-61787789 CCACACATTGTGAAAGAGTGTGG + Intergenic
1042239761 8:66651490-66651512 CCTCACATGTTTCAGCAGGGTGG - Exonic
1043396316 8:79841480-79841502 CCTCACATGGCAAAAGAATGAGG - Intergenic
1048749053 8:137650198-137650220 CCAATCATGGTTAAACAGGGAGG + Intergenic
1049677145 8:143895205-143895227 CCTCACCAGCTTCAACAGTGAGG - Intergenic
1053628811 9:39908081-39908103 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1053777257 9:41558263-41558285 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1054215076 9:62342621-62342643 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1054364475 9:64320223-64320245 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1054672405 9:67812728-67812750 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1057280900 9:93710888-93710910 CAGCACCTGCTTAAACAGTGAGG - Intergenic
1186083695 X:5962779-5962801 CCTCACATGGAAAAAGGGTGAGG - Intronic
1187288536 X:17930138-17930160 CCTCACAGGGTCACCCAGTGAGG - Intergenic
1189641416 X:43075940-43075962 CCTGACATTGTTTCACAGTGTGG - Intergenic
1194579657 X:95656211-95656233 CCTCACATGGTTGAAGAGCAAGG - Intergenic
1195307463 X:103598451-103598473 CCTCACATGGTAGAAGAGTGAGG - Intergenic
1196854411 X:119969543-119969565 CATCACAAGGTCAAGCAGTGGGG - Intergenic
1198251945 X:134887857-134887879 CCTCACATGGTTAAACAGTGAGG + Exonic
1200276273 X:154735942-154735964 CCTCCCATGATTAAGGAGTGGGG + Intronic