ID: 1198255573

View in Genome Browser
Species Human (GRCh38)
Location X:134921485-134921507
Sequence TCATAAGGTAGCCTGAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198255569_1198255573 12 Left 1198255569 X:134921450-134921472 CCTGAGCTCAGATCCTTCATTTG No data
Right 1198255573 X:134921485-134921507 TCATAAGGTAGCCTGAGTAGAGG No data
1198255570_1198255573 -1 Left 1198255570 X:134921463-134921485 CCTTCATTTGTGAAACTTTCCTT No data
Right 1198255573 X:134921485-134921507 TCATAAGGTAGCCTGAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198255573 Original CRISPR TCATAAGGTAGCCTGAGTAG AGG Intergenic
No off target data available for this crispr