ID: 1198258856

View in Genome Browser
Species Human (GRCh38)
Location X:134948499-134948521
Sequence GAGGCTCTTTCAGATGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198258849_1198258856 24 Left 1198258849 X:134948452-134948474 CCAGGGAGCCAATGTCACTCTGG No data
Right 1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG No data
1198258848_1198258856 30 Left 1198258848 X:134948446-134948468 CCTGAGCCAGGGAGCCAATGTCA No data
Right 1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG No data
1198258852_1198258856 16 Left 1198258852 X:134948460-134948482 CCAATGTCACTCTGGAAACAGGT No data
Right 1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198258856 Original CRISPR GAGGCTCTTTCAGATGTCCC TGG Intergenic
No off target data available for this crispr