ID: 1198270319

View in Genome Browser
Species Human (GRCh38)
Location X:135051136-135051158
Sequence TGCCAGGGCTTAAGTGTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198270319_1198270329 15 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270329 X:135051174-135051196 CACAAGAGGTCTCTGGGGATGGG 0: 1
1: 0
2: 3
3: 15
4: 152
1198270319_1198270332 25 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270332 X:135051184-135051206 CTCTGGGGATGGGGAGGAAATGG 0: 1
1: 0
2: 12
3: 116
4: 1007
1198270319_1198270321 -10 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270321 X:135051149-135051171 AGCCCTGGCAGCTATGTGGCAGG 0: 1
1: 1
2: 1
3: 21
4: 214
1198270319_1198270333 26 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270333 X:135051185-135051207 TCTGGGGATGGGGAGGAAATGGG 0: 1
1: 1
2: 9
3: 91
4: 757
1198270319_1198270324 1 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270324 X:135051160-135051182 CTATGTGGCAGGAACACAAGAGG 0: 1
1: 0
2: 0
3: 15
4: 218
1198270319_1198270328 14 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270328 X:135051173-135051195 ACACAAGAGGTCTCTGGGGATGG 0: 1
1: 0
2: 2
3: 22
4: 249
1198270319_1198270327 10 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270327 X:135051169-135051191 AGGAACACAAGAGGTCTCTGGGG 0: 1
1: 0
2: 2
3: 23
4: 277
1198270319_1198270330 16 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270330 X:135051175-135051197 ACAAGAGGTCTCTGGGGATGGGG 0: 1
1: 0
2: 2
3: 23
4: 261
1198270319_1198270325 8 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270325 X:135051167-135051189 GCAGGAACACAAGAGGTCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 173
1198270319_1198270326 9 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270326 X:135051168-135051190 CAGGAACACAAGAGGTCTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 215
1198270319_1198270331 19 Left 1198270319 X:135051136-135051158 CCAGGCACACTTAAGCCCTGGCA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1198270331 X:135051178-135051200 AGAGGTCTCTGGGGATGGGGAGG 0: 1
1: 1
2: 5
3: 80
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198270319 Original CRISPR TGCCAGGGCTTAAGTGTGCC TGG (reversed) Exonic
900405269 1:2490209-2490231 TGCCAGGGCCTGGGTGGGCCAGG - Intronic
900630010 1:3629815-3629837 TGCCCGGGCTTCGATGTGCCTGG + Exonic
902796887 1:18805982-18806004 ACGCAGGGCTTCAGTGTGCCTGG - Intergenic
905972428 1:42152345-42152367 TGCCAGGGCTCAGCTCTGCCAGG - Intergenic
910571135 1:88704738-88704760 TGCCTGGGCTGGAGTGTGCAGGG - Intronic
912822580 1:112879613-112879635 AGCAAGGGCTTATGGGTGCCAGG - Intergenic
913049970 1:115109001-115109023 ACACAGGGCTTAAGAGTGCCTGG + Intergenic
920087288 1:203426847-203426869 TGCTAGGGCTACAATGTGCCAGG + Intergenic
920348271 1:205320904-205320926 TGCCAGAGCTCCAGTGTGCTGGG + Intronic
1064370977 10:14751326-14751348 TGCCAGGAGCTAAGTGTGCTTGG + Intronic
1064430436 10:15266151-15266173 TGCCAGGCCTTCTGTGAGCCAGG - Intronic
1065979596 10:30878840-30878862 TGCAAGGGGTTGAGTGTGGCAGG + Intronic
1066005871 10:31145831-31145853 TGCCAGAGATTAAATGTGCTAGG - Intergenic
1066658224 10:37713859-37713881 TGCCAGGGGTTAAGAGGGGCTGG - Intergenic
1068015842 10:51515776-51515798 TGCAAGGGGTTGAGTGGGCCAGG - Intronic
1070499810 10:77061984-77062006 TGCCAGGGCCTAGGAGTGACAGG + Intronic
1070955215 10:80459281-80459303 GACCAGAGCTTAAGTGGGCCTGG + Intronic
1072795814 10:98353722-98353744 TTCCAGGGCTTCTGTGTCCCTGG - Intergenic
1075734185 10:124653990-124654012 TTCCTGGGCTGAAGTCTGCCAGG + Intronic
1077300118 11:1842884-1842906 TGCCAGGGCTGTAGGGTACCCGG - Intergenic
1077452094 11:2654456-2654478 CTGCAGGGCTTATGTGTGCCTGG - Intronic
1078306770 11:10196164-10196186 TGCCAGGAATTCAGTATGCCAGG - Intronic
1078383720 11:10868604-10868626 TGCCAGGGGTTAAGTGGGAGTGG - Intergenic
1081228584 11:40556171-40556193 TGCTATGGCTTAAATATGCCAGG - Intronic
1084690241 11:70721024-70721046 AGCCCGGGCTTCCGTGTGCCAGG + Intronic
1084961878 11:72721151-72721173 GGGCAGGGCTGAAGAGTGCCGGG + Intronic
1085326710 11:75611974-75611996 TGCCAGAGCTGCAGTGTGCTCGG + Intronic
1085390755 11:76180937-76180959 GGCCAGGGCTGAAGAGAGCCAGG + Intergenic
1086899315 11:92348685-92348707 TGCCAGGACTCAAGTTTCCCAGG - Intergenic
1090074516 11:123571629-123571651 TGCCATGGCTTAAAGGTGGCTGG + Intronic
1090918799 11:131190421-131190443 TGCAAGTGCTTAAGTGGGCTGGG + Intergenic
1091197510 11:133744594-133744616 AGCCATGGCTTGAGTGGGCCCGG + Intergenic
1093393400 12:18651173-18651195 TCCCAGGGATGAAGCGTGCCTGG - Intergenic
1094631408 12:32178863-32178885 TGCCCGGCCTGCAGTGTGCCAGG - Intronic
1095492865 12:42753659-42753681 AGTTAGGACTTAAGTGTGCCTGG - Intergenic
1104356001 12:128087678-128087700 TGCCAGGCCGTGAGTGAGCCTGG - Intergenic
1105860376 13:24405034-24405056 TCTCAGGACTTAAGTATGCCTGG - Intergenic
1106692486 13:32133297-32133319 TGGGAGGGGTTAAGTGTGACTGG - Intronic
1106769471 13:32947918-32947940 TGCCTGTGCTCAAGTGAGCCAGG - Intergenic
1113922291 13:113919868-113919890 TGCCAGATCCTGAGTGTGCCGGG + Intergenic
1113922341 13:113920140-113920162 TGCCAGGCCCTGAGTGTGCTGGG + Intergenic
1113922355 13:113920203-113920225 TGCCAGGCCCTGAGTGTGCTGGG + Intergenic
1115776614 14:36722261-36722283 TGCCAGGGATTAAGTGGGGAGGG + Intronic
1122797312 14:104212513-104212535 TGCCAGGGGCTGTGTGTGCCAGG - Intergenic
1122855769 14:104559443-104559465 TGCCAGTGGGTGAGTGTGCCTGG - Intronic
1124707303 15:31976626-31976648 TGCCTGGACTTGTGTGTGCCTGG + Intergenic
1124903748 15:33848718-33848740 TTCCAGGGCTTAAGTGGCCAAGG + Intronic
1125245771 15:37637151-37637173 AGCCAGAGCTTGAGTGTGCAGGG - Intergenic
1125348664 15:38744701-38744723 TGGAAGAGCTTAAGTTTGCCTGG + Intergenic
1127911494 15:63419841-63419863 TGCCTGGGCCTCAGTGGGCCTGG - Intergenic
1130910780 15:88269552-88269574 TGCCAGGGGCTGTGTGTGCCAGG - Intergenic
1132306505 15:100818507-100818529 TGTCAGGGGTTAAGTGTGGAAGG + Intergenic
1132571407 16:645983-646005 TCCCTGGGCTGAAGTTTGCCCGG + Intronic
1132642264 16:983286-983308 TGCCAGGGCTTCTGGGTGTCTGG + Intronic
1134762827 16:16729163-16729185 TGCCATGGCTTAGGTGAGCCAGG - Intergenic
1134983225 16:18629985-18630007 TGCCATGGCTTAGGTGAGCCAGG + Intergenic
1144798277 17:17907365-17907387 TGTCAGGGCCTAAGGGTGGCAGG - Intronic
1145255854 17:21321989-21322011 GGCCTGGGCGTTAGTGTGCCTGG + Intergenic
1145268311 17:21391147-21391169 TGCCAGGGCTGAGGGATGCCTGG + Intronic
1145320767 17:21765957-21765979 GGCCTGGGCGTTAGTGTGCCTGG - Intergenic
1145780299 17:27558568-27558590 TGCCAGGGCCTCCATGTGCCAGG - Intronic
1146557323 17:33837230-33837252 TACCACGGCTTATGGGTGCCTGG + Intronic
1148727283 17:49802814-49802836 TTCCTGGGCTTAAGTGATCCTGG + Intronic
1149600041 17:57887276-57887298 TGCCTGGGTTTGAGTGGGCCGGG - Intronic
1152583472 17:81179143-81179165 TGGCAGGGCTTACCTCTGCCTGG - Intergenic
1155074110 18:22340325-22340347 TGGCTGGGCTGAAGTGTGACAGG + Intergenic
1156270210 18:35523691-35523713 TGCCAGGCATGTAGTGTGCCAGG - Intergenic
1156506880 18:37601869-37601891 TGCTAGAGCTTAAGTGTGGAGGG - Intergenic
1161141139 19:2648663-2648685 TGCCAGAGCCCAAGGGTGCCAGG - Intronic
1161590563 19:5127415-5127437 TGCCCGGGCTTCACTGAGCCTGG + Intronic
1161731290 19:5962335-5962357 TGCCAGGGCTCCACAGTGCCTGG - Intronic
1162926849 19:13934764-13934786 TGCCTGTGCATAAGTGTGCATGG + Intronic
1164754450 19:30679487-30679509 TGCCAGGGCCTGAGGGTGCAGGG + Intronic
1165357296 19:35312057-35312079 TCCCAGGCCTTCAGTGTCCCTGG - Intronic
1165365242 19:35361356-35361378 TCCCTGGGGTTAAGTGTGCCGGG + Intergenic
1165698645 19:37920458-37920480 TGCAGGGGCTCAAGTGTGCATGG + Intronic
1165731391 19:38147972-38147994 TGTCAAGGCTTCAGTGAGCCAGG + Intronic
1168408903 19:56126272-56126294 TGCCGGGGCCTAACTGTGTCTGG - Intergenic
925297868 2:2790118-2790140 AGGCAGGGCTTGAGTGTTCCAGG - Intergenic
926147620 2:10406275-10406297 AGCCAGGGCTTAAAGGTTCCAGG - Intronic
926236059 2:11044937-11044959 TGCCAGGGGTTAGGTTGGCCTGG - Intergenic
928758298 2:34552440-34552462 TGCCAGGCCCTAAGTATGACTGG + Intergenic
929652940 2:43700335-43700357 TGTCAGAGCTTAACTGTGGCTGG - Exonic
935622096 2:105139170-105139192 TGCCACAGAATAAGTGTGCCTGG + Intergenic
935854686 2:107261014-107261036 TGCCAGGACTTCAGGGTGGCTGG + Intergenic
936253182 2:110884493-110884515 TGTCAGTGCTTAAGGGTGGCAGG - Intronic
937964205 2:127488823-127488845 AGCCATGGGCTAAGTGTGCCAGG - Intronic
941802014 2:169670610-169670632 TCCAAGGGCTTAAATGAGCCTGG + Intronic
942696612 2:178653798-178653820 AGTCAGGGCTAAAGTGTACCTGG + Exonic
942697051 2:178658058-178658080 AGTCAGGGCTAAAGTGTACCTGG + Exonic
942697491 2:178662319-178662341 AGTCAGGGCTAAAGTGTACCTGG + Exonic
946243813 2:218373801-218373823 AGCCAGGGCTGGAGTGTCCCTGG + Intergenic
946677954 2:222182345-222182367 TGCAAGGGCTTGAGTTTGCATGG + Intergenic
946725958 2:222661482-222661504 TGTAAGTTCTTAAGTGTGCCAGG + Intergenic
947542505 2:230988614-230988636 TTCCATGGCTTCAGTGTGCCAGG + Intergenic
947761882 2:232609487-232609509 TTGCAGTGCCTAAGTGTGCCAGG + Intronic
1170033816 20:11969609-11969631 TGTCAGGGCCTCAGTGTGCCTGG + Intergenic
1170574627 20:17653050-17653072 TGCAAGTGATGAAGTGTGCCCGG + Intronic
1170800081 20:19583521-19583543 TGCCAGGGCTGAAGTGAACTGGG + Intronic
1173007499 20:39151328-39151350 GGCCAGGGCTGAAGGGTGCCTGG - Intergenic
1176383480 21:6125626-6125648 TGGCTGGGCATAAGTGTGGCCGG + Intergenic
1179739988 21:43412612-43412634 TGGCTGGGCATAAGTGTGGCCGG - Intergenic
1180202078 21:46229932-46229954 TGTCAGGGCTTCTGTGGGCCAGG - Intergenic
1181621986 22:24097653-24097675 TGTCAGGTCTTAAGTTTGTCAGG + Intronic
1184282198 22:43443560-43443582 TGCCAGGCCCTAAGTATACCAGG - Intronic
1184392324 22:44211599-44211621 TCCCAGGGCATAGCTGTGCCTGG + Intronic
1184608946 22:45590396-45590418 TGCAAGGGGTTCAGTGTGGCTGG + Intronic
1185280942 22:49969601-49969623 TGCCAAGGCTACAGTGTGCCAGG + Intergenic
1185332612 22:50258464-50258486 TGCCAGTGGGTATGTGTGCCAGG - Intronic
954870464 3:53763778-53763800 TGCCAGGTCTTAGGACTGCCAGG - Intronic
957233381 3:77550929-77550951 TGCCAGGCTTTAACTGTGGCAGG + Exonic
960732936 3:120745887-120745909 CCCCAGGGCTTAAGGATGCCTGG - Intronic
962321389 3:134393499-134393521 TGCCAGGGTTTAAGGGTGAGTGG - Intergenic
962733120 3:138300909-138300931 TGCCTCGGCATCAGTGTGCCTGG + Intronic
967363991 3:188664926-188664948 TGGCAGGACCTGAGTGTGCCAGG + Intronic
969246201 4:5934551-5934573 TGCCAGGAGTTAAGTGGGGCCGG - Intronic
971322151 4:25614294-25614316 TGACAGTGCTTAGGTGTGCCTGG + Intergenic
974979955 4:68943338-68943360 TGCCATGGCTTAAGAGAGCTTGG + Intronic
977602693 4:98951152-98951174 TGCCAAGACTTATGTGTCCCAGG - Intergenic
978221220 4:106276836-106276858 TGCCCAGGCTGGAGTGTGCCTGG - Intronic
984011549 4:174377638-174377660 TGCCAACATTTAAGTGTGCCTGG - Intergenic
984582360 4:181524863-181524885 TGCCAGGGATTGAGGGTGCGTGG - Intergenic
989466060 5:41757291-41757313 TGACAGGGATTAAGTGTTGCAGG - Intronic
992273461 5:75089985-75090007 TGCCTGTGCTGCAGTGTGCCTGG - Intronic
994183090 5:96788932-96788954 TGCCAGCCCCAAAGTGTGCCCGG - Intronic
996811502 5:127520636-127520658 TGCCAGGGCTTATGGTTGACGGG + Intronic
1000969365 5:167696987-167697009 TGGCAGGGCTAAACTGTGCAGGG - Intronic
1001685863 5:173594619-173594641 TGCCAGCAATTAATTGTGCCAGG + Intergenic
1002563983 5:180099909-180099931 TGCCAGGGACTGAGGGTGCCAGG + Intergenic
1003182165 6:3801352-3801374 TGCCAGCCCTGCAGTGTGCCGGG + Intergenic
1003855969 6:10275575-10275597 TGTTAGGGCTTAAGTCTGCTGGG - Intergenic
1006442923 6:34063256-34063278 TGCCAGGGGCTCAGAGTGCCGGG + Intronic
1007121039 6:39381647-39381669 TGCCAGAGCTTGTGTGTCCCAGG - Intronic
1010206354 6:73325849-73325871 TGGCTGGGGTTCAGTGTGCCAGG + Intergenic
1014224333 6:118830900-118830922 TGCCAGATCGTAAGTGTGCAAGG + Intronic
1014767964 6:125428861-125428883 TGCCAGCACTCCAGTGTGCCAGG + Intergenic
1015552630 6:134427854-134427876 GGCCAGGGGATAGGTGTGCCTGG + Intergenic
1016941253 6:149484409-149484431 TGACAGGGCTCAAATGTGCCTGG + Intronic
1049171901 8:141166807-141166829 GGCCAGGGCTAAAGTGAGCAGGG + Intronic
1049849999 8:144826046-144826068 TGTGAGGGCCTGAGTGTGCCTGG + Intergenic
1050472473 9:6007774-6007796 TGCCGGGGCATGAGTGTGCCCGG - Exonic
1051588054 9:18747935-18747957 TGCCCAGCCTCAAGTGTGCCTGG - Intronic
1055925929 9:81509771-81509793 TCCCAGGGCTTATGTGGCCCAGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057931090 9:99193758-99193780 TGTGAGGGCTAAACTGTGCCTGG + Intergenic
1061113654 9:128593920-128593942 GGCCTGGGGATAAGTGTGCCTGG + Intronic
1189186213 X:39057584-39057606 GGCAAGGGCTTAAGCCTGCCAGG + Intergenic
1189976909 X:46470354-46470376 TGCCAGGGCTTAAGAATGGGTGG - Intronic
1190380599 X:49836808-49836830 TGCCAGGGCTTAAGGGTCTTGGG + Intergenic
1190385221 X:49878367-49878389 TGCCAGGGCTTAAGGGTCTTGGG + Intergenic
1196062115 X:111420313-111420335 TGCCAGGGGTTAGGTGTGGAGGG + Intergenic
1197673075 X:129299800-129299822 TGTCAGGTCTGGAGTGTGCCTGG + Intergenic
1198267238 X:135021484-135021506 TGCCAGGGCTCAGTTGTGCCTGG - Exonic
1198270319 X:135051136-135051158 TGCCAGGGCTTAAGTGTGCCTGG - Exonic