ID: 1198274445

View in Genome Browser
Species Human (GRCh38)
Location X:135087954-135087976
Sequence TGGTTGTTACAGATGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198274437_1198274445 23 Left 1198274437 X:135087908-135087930 CCCCTGATATCTGTAGGAAGTGG No data
Right 1198274445 X:135087954-135087976 TGGTTGTTACAGATGGATTCTGG No data
1198274439_1198274445 22 Left 1198274439 X:135087909-135087931 CCCTGATATCTGTAGGAAGTGGT No data
Right 1198274445 X:135087954-135087976 TGGTTGTTACAGATGGATTCTGG No data
1198274440_1198274445 21 Left 1198274440 X:135087910-135087932 CCTGATATCTGTAGGAAGTGGTG No data
Right 1198274445 X:135087954-135087976 TGGTTGTTACAGATGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198274445 Original CRISPR TGGTTGTTACAGATGGATTC TGG Intergenic
No off target data available for this crispr