ID: 1198274875

View in Genome Browser
Species Human (GRCh38)
Location X:135090786-135090808
Sequence TGTCTTGGCCTTGTAGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198274875_1198274881 4 Left 1198274875 X:135090786-135090808 CCATTAACTACAAGGCCAAGACA No data
Right 1198274881 X:135090813-135090835 TGTCCAAGGAGAAGGCCCCAGGG No data
1198274875_1198274883 15 Left 1198274875 X:135090786-135090808 CCATTAACTACAAGGCCAAGACA No data
Right 1198274883 X:135090824-135090846 AAGGCCCCAGGGTTAGAGCCAGG No data
1198274875_1198274887 30 Left 1198274875 X:135090786-135090808 CCATTAACTACAAGGCCAAGACA No data
Right 1198274887 X:135090839-135090861 GAGCCAGGAGCCCAGACTAAAGG No data
1198274875_1198274876 -10 Left 1198274875 X:135090786-135090808 CCATTAACTACAAGGCCAAGACA No data
Right 1198274876 X:135090799-135090821 GGCCAAGACATCCATGTCCAAGG No data
1198274875_1198274878 -4 Left 1198274875 X:135090786-135090808 CCATTAACTACAAGGCCAAGACA No data
Right 1198274878 X:135090805-135090827 GACATCCATGTCCAAGGAGAAGG No data
1198274875_1198274880 3 Left 1198274875 X:135090786-135090808 CCATTAACTACAAGGCCAAGACA No data
Right 1198274880 X:135090812-135090834 ATGTCCAAGGAGAAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198274875 Original CRISPR TGTCTTGGCCTTGTAGTTAA TGG (reversed) Intergenic
No off target data available for this crispr