ID: 1198274877

View in Genome Browser
Species Human (GRCh38)
Location X:135090801-135090823
Sequence CTCCTTGGACATGGATGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198274877_1198274883 0 Left 1198274877 X:135090801-135090823 CCAAGACATCCATGTCCAAGGAG No data
Right 1198274883 X:135090824-135090846 AAGGCCCCAGGGTTAGAGCCAGG No data
1198274877_1198274890 24 Left 1198274877 X:135090801-135090823 CCAAGACATCCATGTCCAAGGAG No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274877_1198274887 15 Left 1198274877 X:135090801-135090823 CCAAGACATCCATGTCCAAGGAG No data
Right 1198274887 X:135090839-135090861 GAGCCAGGAGCCCAGACTAAAGG No data
1198274877_1198274889 23 Left 1198274877 X:135090801-135090823 CCAAGACATCCATGTCCAAGGAG No data
Right 1198274889 X:135090847-135090869 AGCCCAGACTAAAGGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198274877 Original CRISPR CTCCTTGGACATGGATGTCT TGG (reversed) Intergenic