ID: 1198274882

View in Genome Browser
Species Human (GRCh38)
Location X:135090816-135090838
Sequence TAACCCTGGGGCCTTCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198274882_1198274887 0 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274887 X:135090839-135090861 GAGCCAGGAGCCCAGACTAAAGG No data
1198274882_1198274893 26 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274893 X:135090865-135090887 TGTGGGCGAGCCTGCCAGCATGG No data
1198274882_1198274889 8 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274889 X:135090847-135090869 AGCCCAGACTAAAGGCAGTGTGG No data
1198274882_1198274890 9 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274882_1198274894 27 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274894 X:135090866-135090888 GTGGGCGAGCCTGCCAGCATGGG No data
1198274882_1198274895 30 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274895 X:135090869-135090891 GGCGAGCCTGCCAGCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198274882 Original CRISPR TAACCCTGGGGCCTTCTCCT TGG (reversed) Intergenic
No off target data available for this crispr